Incidental Mutation 'R6385:Ppp3r2'
ID515545
Institutional Source Beutler Lab
Gene Symbol Ppp3r2
Ensembl Gene ENSMUSG00000028310
Gene Nameprotein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II)
SynonymsCnB2, CaNB2, PP2B beta 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6385 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location49678747-49682024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49681767 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 61 (I61T)
Ref Sequence ENSEMBL: ENSMUSP00000029991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029991] [ENSMUST00000076674] [ENSMUST00000093859]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029991
AA Change: I61T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029991
Gene: ENSMUSG00000028310
AA Change: I61T

DomainStartEndE-ValueType
EFh 22 50 1.72e0 SMART
EFh 54 82 2.37e-3 SMART
EFh 91 119 4.19e-4 SMART
EFh 132 160 1.73e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076674
SMART Domains Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1063 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093859
SMART Domains Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1083 1125 N/A INTRINSIC
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to reduced hyperactivated sperm motility and midpiece rigidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,279 M910L probably benign Het
Abca9 T A 11: 110,134,254 I988F probably damaging Het
Adgra2 A T 8: 27,118,850 S92C probably damaging Het
Apon A G 10: 128,254,354 probably benign Het
Arap3 G A 18: 37,997,031 R26* probably null Het
BC049730 A T 7: 24,714,110 I184F probably damaging Het
Btnl6 T G 17: 34,508,369 I396L probably benign Het
Catsper3 G T 13: 55,786,426 Q53H probably damaging Het
Cep164 T G 9: 45,779,783 E372A probably damaging Het
Cln3 A T 7: 126,575,035 C339S probably null Het
Cntnap2 G A 6: 46,856,180 D776N probably benign Het
Cttnbp2nl A G 3: 105,005,636 F311L probably benign Het
Daam2 C T 17: 49,463,936 A918T probably damaging Het
Dst T C 1: 34,307,468 V7353A possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fanca A T 8: 123,305,867 probably null Het
Filip1 G T 9: 79,820,531 Q269K possibly damaging Het
Fut9 G A 4: 25,620,328 S162L probably damaging Het
Gtf2ird1 A T 5: 134,404,690 H294Q probably benign Het
Gucy1a1 A G 3: 82,109,006 I225T probably benign Het
H2-DMb1 T A 17: 34,155,602 N75K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hes1 A G 16: 30,065,606 M6V possibly damaging Het
Hydin A T 8: 110,312,224 H198L possibly damaging Het
Iars T C 13: 49,701,895 L266P probably damaging Het
Ifna11 A G 4: 88,820,149 E64G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Lama5 T C 2: 180,196,533 T850A probably damaging Het
Lgi3 A G 14: 70,531,170 T36A possibly damaging Het
Lrp2 T C 2: 69,495,784 S1810G probably benign Het
Msln T A 17: 25,751,141 D280V probably benign Het
Myh4 A T 11: 67,255,837 I1513F probably damaging Het
Ncf2 A T 1: 152,830,422 M262L probably benign Het
Neb G T 2: 52,185,299 A218D probably damaging Het
Notch4 C A 17: 34,573,814 Q640K probably null Het
Olfr1303 T C 2: 111,814,619 I36V probably benign Het
Olfr231 A T 1: 174,117,296 F240Y probably damaging Het
Olfr603 A T 7: 103,383,897 V35D possibly damaging Het
Pear1 G T 3: 87,754,199 H562N probably benign Het
Poli C A 18: 70,530,001 probably benign Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Serhl A G 15: 83,101,622 T5A probably benign Het
Shank3 T C 15: 89,521,375 probably null Het
Slc22a28 A G 19: 8,101,480 S282P probably damaging Het
Slc2a12 C T 10: 22,694,030 T540I possibly damaging Het
Slurp2 T C 15: 74,746,675 M1V probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tln2 C T 9: 67,278,129 A700T probably benign Het
Ttn C T 2: 76,917,848 V4286I probably benign Het
Ube2u A G 4: 100,532,144 K214R possibly damaging Het
Vmn1r46 A G 6: 89,976,445 H92R probably damaging Het
Wdr90 A G 17: 25,848,530 I1486T probably damaging Het
Zc3h11a A T 1: 133,637,454 S236T possibly damaging Het
Zfp318 A G 17: 46,411,006 K1312E probably damaging Het
Zfp930 A G 8: 69,228,631 Y326C probably damaging Het
Zfp972 G T 2: 177,921,795 D8E probably damaging Het
Other mutations in Ppp3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Ppp3r2 APN 4 49681773 missense possibly damaging 0.84
IGL03371:Ppp3r2 APN 4 49681630 missense probably damaging 1.00
R0365:Ppp3r2 UTSW 4 49681902 missense possibly damaging 0.77
R0928:Ppp3r2 UTSW 4 49681439 critical splice donor site probably null
R1957:Ppp3r2 UTSW 4 49681726 missense probably damaging 1.00
R2021:Ppp3r2 UTSW 4 49681723 missense probably benign 0.02
R2022:Ppp3r2 UTSW 4 49681723 missense probably benign 0.02
R2023:Ppp3r2 UTSW 4 49681723 missense probably benign 0.02
R6102:Ppp3r2 UTSW 4 49682022 intron probably benign
Predicted Primers PCR Primer
(F):5'- AAGATGCTCTTGTCCACCAG -3'
(R):5'- CCAGCTACCAAACTGAGCTGTG -3'

Sequencing Primer
(F):5'- TGCAGCTGCCAGTCCTTGAG -3'
(R):5'- TGAGCTGTGCAACCACTTCG -3'
Posted On2018-05-04