Incidental Mutation 'R6385:Cntnap2'
ID515550
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Namecontactin associated protein-like 2
Synonyms5430425M22Rik, Caspr2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R6385 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location45059357-47304213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46856180 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 776 (D776N)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
Predicted Effect probably benign
Transcript: ENSMUST00000114641
AA Change: D776N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: D776N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,279 M910L probably benign Het
Abca9 T A 11: 110,134,254 I988F probably damaging Het
Adgra2 A T 8: 27,118,850 S92C probably damaging Het
Apon A G 10: 128,254,354 probably benign Het
Arap3 G A 18: 37,997,031 R26* probably null Het
BC049730 A T 7: 24,714,110 I184F probably damaging Het
Btnl6 T G 17: 34,508,369 I396L probably benign Het
Catsper3 G T 13: 55,786,426 Q53H probably damaging Het
Cep164 T G 9: 45,779,783 E372A probably damaging Het
Cln3 A T 7: 126,575,035 C339S probably null Het
Cttnbp2nl A G 3: 105,005,636 F311L probably benign Het
Daam2 C T 17: 49,463,936 A918T probably damaging Het
Dst T C 1: 34,307,468 V7353A possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fanca A T 8: 123,305,867 probably null Het
Filip1 G T 9: 79,820,531 Q269K possibly damaging Het
Fut9 G A 4: 25,620,328 S162L probably damaging Het
Gtf2ird1 A T 5: 134,404,690 H294Q probably benign Het
Gucy1a1 A G 3: 82,109,006 I225T probably benign Het
H2-DMb1 T A 17: 34,155,602 N75K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hes1 A G 16: 30,065,606 M6V possibly damaging Het
Hydin A T 8: 110,312,224 H198L possibly damaging Het
Iars T C 13: 49,701,895 L266P probably damaging Het
Ifna11 A G 4: 88,820,149 E64G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Lama5 T C 2: 180,196,533 T850A probably damaging Het
Lgi3 A G 14: 70,531,170 T36A possibly damaging Het
Lrp2 T C 2: 69,495,784 S1810G probably benign Het
Msln T A 17: 25,751,141 D280V probably benign Het
Myh4 A T 11: 67,255,837 I1513F probably damaging Het
Ncf2 A T 1: 152,830,422 M262L probably benign Het
Neb G T 2: 52,185,299 A218D probably damaging Het
Notch4 C A 17: 34,573,814 Q640K probably null Het
Olfr1303 T C 2: 111,814,619 I36V probably benign Het
Olfr231 A T 1: 174,117,296 F240Y probably damaging Het
Olfr603 A T 7: 103,383,897 V35D possibly damaging Het
Pear1 G T 3: 87,754,199 H562N probably benign Het
Poli C A 18: 70,530,001 probably benign Het
Ppp3r2 A G 4: 49,681,767 I61T possibly damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Serhl A G 15: 83,101,622 T5A probably benign Het
Shank3 T C 15: 89,521,375 probably null Het
Slc22a28 A G 19: 8,101,480 S282P probably damaging Het
Slc2a12 C T 10: 22,694,030 T540I possibly damaging Het
Slurp2 T C 15: 74,746,675 M1V probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tln2 C T 9: 67,278,129 A700T probably benign Het
Ttn C T 2: 76,917,848 V4286I probably benign Het
Ube2u A G 4: 100,532,144 K214R possibly damaging Het
Vmn1r46 A G 6: 89,976,445 H92R probably damaging Het
Wdr90 A G 17: 25,848,530 I1486T probably damaging Het
Zc3h11a A T 1: 133,637,454 S236T possibly damaging Het
Zfp318 A G 17: 46,411,006 K1312E probably damaging Het
Zfp930 A G 8: 69,228,631 Y326C probably damaging Het
Zfp972 G T 2: 177,921,795 D8E probably damaging Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 utr 5 prime probably null
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.27
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAGTTGCCTCTGAGCCATG -3'
(R):5'- AGATCCATTGGTCCTACTTGTG -3'

Sequencing Primer
(F):5'- GCCATGCTCTGGGGAAAG -3'
(R):5'- ATCCATTGGTCCTACTTGTGTTGTG -3'
Posted On2018-05-04