Mutagenetix > Incidental Mutation

Incidental Mutation 'R6388:Eif5b'

515623

Institutional Source

Beutler Lab

Gene Symbol

Eif5b

Ensembl Gene

ENSMUSG00000026083

Gene Name

eukaryotic translation initiation factor 5B

Synonyms

IF2, A030003E17Rik

MMRRC Submission

044537-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6388 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38037091-38094660 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38058081 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 128 (A128T)

Ref Sequence

ENSEMBL: ENSMUSP00000027252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027252]

AlphaFold

Q05D44

Predicted Effect

unknown
Transcript: ENSMUST00000027252
AA Change: A128T

SMART Domains

Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: A128T

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
low complexity region	33	51	N/A	INTRINSIC
low complexity region	94	106	N/A	INTRINSIC
low complexity region	110	126	N/A	INTRINSIC
low complexity region	145	161	N/A	INTRINSIC
low complexity region	183	193	N/A	INTRINSIC
coiled coil region	227	272	N/A	INTRINSIC
coiled coil region	301	414	N/A	INTRINSIC
low complexity region	480	498	N/A	INTRINSIC
coiled coil region	523	554	N/A	INTRINSIC
low complexity region	580	594	N/A	INTRINSIC
Pfam:GTP_EFTU	625	840	4.7e-35	PFAM
Pfam:MMR_HSR1	629	753	5.1e-6	PFAM
Pfam:GTP_EFTU_D2	866	944	7.1e-11	PFAM
Pfam:IF-2	959	1066	1.4e-20	PFAM
Blast:S1	1116	1172	2e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192548

Meta Mutation Damage Score

0.0602

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.8%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,410,230 (GRCm39)	R560W	probably benign	Het
Abi3	A	G	11: 95,724,464 (GRCm39)		probably null	Het
Ap1b1	T	C	11: 4,976,319 (GRCm39)	I449T	probably damaging	Het
Atpaf2	C	A	11: 60,307,833 (GRCm39)		probably benign	Het
Car5a	T	C	8: 122,653,910 (GRCm39)	Y118C	probably damaging	Het
Ccdc18	A	G	5: 108,349,214 (GRCm39)	D1002G	possibly damaging	Het
Ciao1	A	T	2: 127,088,396 (GRCm39)	C142*	probably null	Het
Clec14a	A	G	12: 58,314,243 (GRCm39)	*460R	probably null	Het
Defb30	T	A	14: 63,287,213 (GRCm39)		probably benign	Het
Dnah10	A	G	5: 124,906,710 (GRCm39)	K4247R	probably benign	Het
Fam3b	T	C	16: 97,279,591 (GRCm39)	T113A	probably benign	Het
Fam98c	C	T	7: 28,854,728 (GRCm39)	R126Q	probably damaging	Het
Fastkd3	C	T	13: 68,738,319 (GRCm39)	L623F	probably damaging	Het
Golga1	T	C	2: 38,913,183 (GRCm39)	D543G	probably benign	Het
Gpatch8	A	T	11: 102,369,314 (GRCm39)	V1408E	probably damaging	Het
Icosl	T	A	10: 77,905,366 (GRCm39)	L3Q	possibly damaging	Homo
Igf2r	A	G	17: 12,902,787 (GRCm39)	V2421A	probably benign	Het
Iglon5	T	C	7: 43,127,556 (GRCm39)	T165A	possibly damaging	Het
Map3k11	A	G	19: 5,740,279 (GRCm39)	E2G	probably damaging	Het
Nipbl	A	T	15: 8,330,268 (GRCm39)	C2386S	probably damaging	Het
Nos1	A	G	5: 118,052,501 (GRCm39)	E837G	possibly damaging	Het
Npc1l1	T	C	11: 6,174,145 (GRCm39)	E720G	probably damaging	Het
Or1e35	A	G	11: 73,798,118 (GRCm39)	S67P	probably damaging	Het
Pla1a	T	A	16: 38,217,834 (GRCm39)	M385L	probably benign	Het
Saxo4	A	G	19: 10,459,665 (GRCm39)	V14A	probably damaging	Het
Setdb2	T	C	14: 59,662,146 (GRCm39)	T82A	probably benign	Het
Smarcd3	A	G	5: 24,801,024 (GRCm39)	F128L	possibly damaging	Het
St3gal1	A	G	15: 66,983,195 (GRCm39)	V187A	possibly damaging	Het
Syvn1	T	A	19: 6,102,381 (GRCm39)	V483E	probably damaging	Het
Timm22	G	A	11: 76,297,945 (GRCm39)	V19I	probably benign	Het
Ttn	C	A	2: 76,621,189 (GRCm39)	D15716Y	probably damaging	Het
Ube3a	C	T	7: 58,954,669 (GRCm39)		probably null	Het
Ugp2	A	G	11: 21,272,051 (GRCm39)		probably null	Het
Vmn1r13	T	A	6: 57,186,903 (GRCm39)	F21I	probably benign	Het
Vps13d	T	C	4: 144,882,144 (GRCm39)	S1150G	probably benign	Het
Zp3	T	C	5: 136,011,548 (GRCm39)	V122A	probably benign	Het

Other mutations in Eif5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Eif5b	APN	1	38,080,800 (GRCm39)	missense	probably damaging	1.00
IGL01377:Eif5b	APN	1	38,075,179 (GRCm39)	missense	probably benign
IGL01395:Eif5b	APN	1	38,076,339 (GRCm39)	missense	probably damaging	0.96
IGL01572:Eif5b	APN	1	38,061,335 (GRCm39)	nonsense	probably null
IGL01615:Eif5b	APN	1	38,084,787 (GRCm39)	missense	probably damaging	1.00
IGL02141:Eif5b	APN	1	38,071,403 (GRCm39)	missense	probably benign	0.09
IGL02260:Eif5b	APN	1	38,084,537 (GRCm39)	missense	possibly damaging	0.81
IGL02308:Eif5b	APN	1	38,080,828 (GRCm39)	missense	probably damaging	1.00
IGL03180:Eif5b	APN	1	38,075,350 (GRCm39)	missense	probably damaging	1.00
IGL03327:Eif5b	APN	1	38,080,772 (GRCm39)	splice site	probably benign
R0018:Eif5b	UTSW	1	38,057,970 (GRCm39)	missense	unknown
R0036:Eif5b	UTSW	1	38,058,192 (GRCm39)	missense	probably benign	0.23
R0137:Eif5b	UTSW	1	38,058,324 (GRCm39)	missense	probably benign	0.23
R0349:Eif5b	UTSW	1	38,071,447 (GRCm39)	missense	probably benign	0.18
R0606:Eif5b	UTSW	1	38,087,974 (GRCm39)	missense	probably damaging	1.00
R1056:Eif5b	UTSW	1	38,061,248 (GRCm39)	missense	unknown
R1225:Eif5b	UTSW	1	38,076,709 (GRCm39)	missense	probably damaging	1.00
R2043:Eif5b	UTSW	1	38,080,900 (GRCm39)	missense	probably damaging	1.00
R2163:Eif5b	UTSW	1	38,087,875 (GRCm39)	missense	probably benign	0.32
R2225:Eif5b	UTSW	1	38,058,304 (GRCm39)	missense	unknown
R2432:Eif5b	UTSW	1	38,058,423 (GRCm39)	missense	unknown
R2922:Eif5b	UTSW	1	38,057,100 (GRCm39)	splice site	probably benign
R4357:Eif5b	UTSW	1	38,089,339 (GRCm39)	missense	probably damaging	1.00
R4631:Eif5b	UTSW	1	38,080,828 (GRCm39)	missense	probably damaging	1.00
R4665:Eif5b	UTSW	1	38,084,793 (GRCm39)	missense	probably damaging	1.00
R4702:Eif5b	UTSW	1	38,057,958 (GRCm39)	missense	unknown
R4941:Eif5b	UTSW	1	38,090,280 (GRCm39)	missense	probably damaging	1.00
R4995:Eif5b	UTSW	1	38,090,792 (GRCm39)	makesense	probably null
R5020:Eif5b	UTSW	1	38,058,150 (GRCm39)	nonsense	probably null
R5175:Eif5b	UTSW	1	38,084,468 (GRCm39)	missense	probably damaging	1.00
R5375:Eif5b	UTSW	1	38,084,835 (GRCm39)	missense	possibly damaging	0.66
R5566:Eif5b	UTSW	1	38,090,328 (GRCm39)	missense	probably damaging	1.00
R5566:Eif5b	UTSW	1	38,084,765 (GRCm39)	missense	possibly damaging	0.90
R5853:Eif5b	UTSW	1	38,076,388 (GRCm39)	missense	probably damaging	1.00
R5978:Eif5b	UTSW	1	38,037,361 (GRCm39)	splice site	probably null
R6315:Eif5b	UTSW	1	38,057,114 (GRCm39)	missense	unknown
R6376:Eif5b	UTSW	1	38,084,760 (GRCm39)	missense	probably damaging	0.98
R6444:Eif5b	UTSW	1	38,075,292 (GRCm39)	missense	probably damaging	1.00
R6455:Eif5b	UTSW	1	38,058,108 (GRCm39)	missense	probably benign	0.23
R6810:Eif5b	UTSW	1	38,085,741 (GRCm39)	missense	probably benign	0.45
R6877:Eif5b	UTSW	1	38,089,320 (GRCm39)	missense	probably damaging	1.00
R7130:Eif5b	UTSW	1	38,080,857 (GRCm39)	missense	probably damaging	1.00
R7180:Eif5b	UTSW	1	38,088,155 (GRCm39)	missense	probably damaging	0.98
R7439:Eif5b	UTSW	1	38,090,718 (GRCm39)	missense	probably benign	0.28
R7488:Eif5b	UTSW	1	38,089,387 (GRCm39)	missense	possibly damaging	0.69
R8140:Eif5b	UTSW	1	38,090,357 (GRCm39)	missense	probably benign	0.41
R8166:Eif5b	UTSW	1	38,087,901 (GRCm39)	missense	probably benign	0.11
R8191:Eif5b	UTSW	1	38,075,283 (GRCm39)	missense	probably damaging	0.98
R8304:Eif5b	UTSW	1	38,084,774 (GRCm39)	missense	probably benign	0.11
R8549:Eif5b	UTSW	1	38,076,288 (GRCm39)	missense	possibly damaging	0.96
R8558:Eif5b	UTSW	1	38,083,795 (GRCm39)	missense	probably damaging	0.99
R8893:Eif5b	UTSW	1	38,090,300 (GRCm39)	missense	possibly damaging	0.48
R9452:Eif5b	UTSW	1	38,084,861 (GRCm39)	missense	probably damaging	1.00
R9487:Eif5b	UTSW	1	38,084,560 (GRCm39)	missense	probably damaging	0.99
R9487:Eif5b	UTSW	1	38,058,451 (GRCm39)	nonsense	probably null
R9542:Eif5b	UTSW	1	38,057,131 (GRCm39)	nonsense	probably null
R9721:Eif5b	UTSW	1	38,076,740 (GRCm39)	critical splice donor site	probably null
R9745:Eif5b	UTSW	1	38,084,729 (GRCm39)	missense	probably damaging	1.00
R9748:Eif5b	UTSW	1	38,090,241 (GRCm39)	missense	possibly damaging	0.89
RF018:Eif5b	UTSW	1	38,060,673 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CACTGAGTGAAGTGCTCCAC -3'
(R):5'- ACTTTCACCAGAGGAGTTTACTC -3'

Sequencing Primer
(F):5'- CCATGACCTTTAAGGGATGACAGTC -3'
(R):5'- CAGAGGAGTTTACTCTCGAACGTTC -3'

Posted On

2018-05-04