Incidental Mutation 'R6389:4931406B18Rik'
List |< first << previous [record 100 of 10171] next >> last >|
ID515693
Institutional Source Beutler Lab
Gene Symbol 4931406B18Rik
Ensembl Gene ENSMUSG00000013353
Gene NameRIKEN cDNA 4931406B18 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.022) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43492044-43505940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43497830 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 326 (L326R)
Ref Sequence ENSEMBL: ENSMUSP00000139468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013497] [ENSMUST00000163474] [ENSMUST00000163619] [ENSMUST00000168213] [ENSMUST00000168883] [ENSMUST00000171174] [ENSMUST00000191516]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013497
AA Change: L326R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000013497
Gene: ENSMUSG00000013353
AA Change: L326R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:2ZG3|A 24 185 9e-7 PDB
Blast:IG_like 119 185 3e-19 BLAST
low complexity region 186 205 N/A INTRINSIC
SCOP:d1iray3 219 297 6e-3 SMART
transmembrane domain 311 333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163474
AA Change: L232R

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126619
Gene: ENSMUSG00000013353
AA Change: L232R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG_like 23 111 3e-12 BLAST
SCOP:d1he7a_ 111 203 1e-3 SMART
Blast:IG_like 125 194 1e-5 BLAST
transmembrane domain 217 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163619
SMART Domains Protein: ENSMUSP00000131071
Gene: ENSMUSG00000013353

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PDB:2ZG3|A 17 88 1e-5 PDB
Blast:IG_like 22 88 2e-21 BLAST
low complexity region 89 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168213
SMART Domains Protein: ENSMUSP00000129928
Gene: ENSMUSG00000013353

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG_like 23 119 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168636
Predicted Effect probably benign
Transcript: ENSMUST00000168883
Predicted Effect possibly damaging
Transcript: ENSMUST00000171174
AA Change: L326R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129888
Gene: ENSMUSG00000013353
AA Change: L326R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_2 113 216 5.6e-3 PFAM
Pfam:Ig_2 200 297 7.7e-3 PFAM
transmembrane domain 311 333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191516
AA Change: L326R

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139468
Gene: ENSMUSG00000013353
AA Change: L326R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_2 113 216 5.6e-3 PFAM
Pfam:Ig_2 200 297 7.7e-3 PFAM
transmembrane domain 311 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Map3k1 T C 13: 111,769,441 D289G probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in 4931406B18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:4931406B18Rik APN 7 43504175 splice site probably benign
IGL01902:4931406B18Rik APN 7 43497843 missense probably damaging 0.96
IGL02616:4931406B18Rik APN 7 43501013 splice site probably null
IGL02677:4931406B18Rik APN 7 43501095 nonsense probably null
IGL03030:4931406B18Rik APN 7 43495633 missense possibly damaging 0.62
R0007:4931406B18Rik UTSW 7 43498042 splice site probably benign
R0788:4931406B18Rik UTSW 7 43499199 missense probably damaging 0.98
R1544:4931406B18Rik UTSW 7 43498119 missense possibly damaging 0.92
R2995:4931406B18Rik UTSW 7 43499368 missense probably damaging 1.00
R4656:4931406B18Rik UTSW 7 43501141 missense probably benign 0.20
R5595:4931406B18Rik UTSW 7 43497872 missense possibly damaging 0.92
R6288:4931406B18Rik UTSW 7 43498125 missense probably damaging 1.00
R6651:4931406B18Rik UTSW 7 43498072 missense possibly damaging 0.81
R6912:4931406B18Rik UTSW 7 43501147 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGAGAAAAGGAGCCTTCAGTC -3'
(R):5'- CCAGGATGAGCACAAACATG -3'

Sequencing Primer
(F):5'- CTATGAAGGGCACATGCATTTGC -3'
(R):5'- TGAGCACAAACATGGAGCAG -3'
Posted On2018-05-04