Incidental Mutation 'R6389:Map3k1'
ID515710
Institutional Source Beutler Lab
Gene Symbol Map3k1
Ensembl Gene ENSMUSG00000021754
Gene Namemitogen-activated protein kinase kinase kinase 1
SynonymsMekk, MEKK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R6389 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location111746428-111808993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111769441 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 289 (D289G)
Ref Sequence ENSEMBL: ENSMUSP00000104890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109267] [ENSMUST00000145055]
Predicted Effect probably damaging
Transcript: ENSMUST00000109267
AA Change: D289G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104890
Gene: ENSMUSG00000021754
AA Change: D289G

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
low complexity region 85 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
Pfam:SWIM 333 361 3.1e-7 PFAM
low complexity region 417 426 N/A INTRINSIC
RING 438 486 2.69e-1 SMART
low complexity region 512 527 N/A INTRINSIC
low complexity region 596 625 N/A INTRINSIC
low complexity region 750 762 N/A INTRINSIC
low complexity region 967 978 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
S_TKc 1224 1489 9.58e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133364
Predicted Effect probably damaging
Transcript: ENSMUST00000145055
AA Change: D131G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117863
Gene: ENSMUSG00000021754
AA Change: D131G

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
Pfam:SWIM 175 203 2.2e-8 PFAM
low complexity region 259 264 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele are born with one or both eyes open, defects in eye morphology, and defects in ear morphology and function. Mice homozygous for a knock-out allele are born with open eyes and exhibit increased response to aortic banding and blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,497,830 L326R possibly damaging Het
5430403G16Rik G A 5: 109,676,019 P522S possibly damaging Het
Abcb11 A T 2: 69,323,894 N109K probably damaging Het
Actn1 T A 12: 80,174,522 M586L probably benign Het
Ago4 T A 4: 126,507,244 I603F probably damaging Het
Bicc1 A T 10: 70,958,922 V135D probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Cadm4 A C 7: 24,499,534 Q78P probably benign Het
Ccdc114 G T 7: 45,948,516 V617F probably benign Het
Cfap74 T C 4: 155,423,336 I248T possibly damaging Het
Clu G C 14: 65,971,322 probably benign Het
Cnnm3 T C 1: 36,520,522 V514A probably damaging Het
Cntd1 A T 11: 101,285,751 I225F probably damaging Het
Col20a1 T C 2: 180,992,583 probably null Het
Ctnnal1 A G 4: 56,813,849 V640A probably benign Het
Cul4a A G 8: 13,140,278 T572A probably benign Het
D16Ertd472e A G 16: 78,545,183 S270P probably damaging Het
Dmp1 A T 5: 104,212,922 N488I probably damaging Het
Dnah14 G A 1: 181,651,202 probably null Het
Dst T C 1: 34,193,184 L3464P probably damaging Het
Fnbp4 C T 2: 90,745,535 P27S unknown Het
Fpr-rs3 A T 17: 20,623,968 F304I probably damaging Het
Gm13941 T C 2: 111,098,389 Q108R unknown Het
Hcn3 C T 3: 89,150,933 A339T possibly damaging Het
Inpp5f A G 7: 128,678,056 D460G probably damaging Het
Ism2 T C 12: 87,282,371 E253G possibly damaging Het
Klrg1 T C 6: 122,271,472 N156S probably damaging Het
Ksr2 A G 5: 117,414,842 N5S probably benign Het
Lrrc7 T G 3: 158,185,426 E368A probably damaging Het
Ly9 G C 1: 171,596,537 S482C probably damaging Het
Mcub T C 3: 129,918,708 T173A probably benign Het
Mup16 T C 4: 61,518,940 E48G probably damaging Het
Naf1 C T 8: 66,861,028 S24L possibly damaging Het
Ncoa6 A G 2: 155,395,816 S2024P probably damaging Het
Nop56 C A 2: 130,277,887 Q83K probably damaging Het
Nt5e T C 9: 88,363,471 Y265H probably damaging Het
Olfr1151 C T 2: 87,858,023 P283S probably damaging Het
Olfr1197 A G 2: 88,728,672 V309A probably benign Het
Olfr551 A T 7: 102,588,472 N90K probably benign Het
Oxct2a T A 4: 123,323,427 K54* probably null Het
Oxct2b G T 4: 123,116,574 D96Y probably benign Het
Pisd A G 5: 32,764,847 Y250H probably damaging Het
Plekhm1 G T 11: 103,366,894 N1071K probably benign Het
Prr11 G A 11: 87,098,738 T269I possibly damaging Het
Ptpn4 T A 1: 119,721,954 H304L probably damaging Het
Rrp1b A G 17: 32,056,627 K383E possibly damaging Het
Sel1l2 C A 2: 140,245,354 A466S probably damaging Het
Slc9a4 A G 1: 40,580,684 I57V probably benign Het
Spag9 A G 11: 94,086,311 E81G probably damaging Het
Tbr1 A G 2: 61,806,287 probably benign Het
Tnrc6c A G 11: 117,722,741 D735G probably damaging Het
Tspan17 A T 13: 54,795,616 probably null Het
Tyw5 T C 1: 57,391,499 K175R probably damaging Het
Ube2o A C 11: 116,548,858 I162R probably null Het
Ubr1 G T 2: 120,881,039 T1458K probably benign Het
Vmn2r16 A T 5: 109,330,478 Q33L probably benign Het
Zfp799 A G 17: 32,820,578 L238P probably damaging Het
Other mutations in Map3k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01594:Map3k1 APN 13 111758189 critical splice acceptor site probably null
IGL01686:Map3k1 APN 13 111754662 missense possibly damaging 0.51
IGL02104:Map3k1 APN 13 111756243 missense probably damaging 0.99
IGL03071:Map3k1 APN 13 111755525 missense possibly damaging 0.77
IGL03087:Map3k1 APN 13 111749025 missense probably benign 0.01
IGL03213:Map3k1 APN 13 111748892 utr 3 prime probably benign
R0005:Map3k1 UTSW 13 111755704 missense probably benign 0.00
R0025:Map3k1 UTSW 13 111756129 missense probably benign
R0506:Map3k1 UTSW 13 111755764 nonsense probably null
R0540:Map3k1 UTSW 13 111763510 missense probably benign 0.05
R0607:Map3k1 UTSW 13 111763510 missense probably benign 0.05
R0898:Map3k1 UTSW 13 111767956 unclassified probably benign
R1171:Map3k1 UTSW 13 111755643 missense probably benign 0.29
R1464:Map3k1 UTSW 13 111755871 missense possibly damaging 0.67
R1464:Map3k1 UTSW 13 111755871 missense possibly damaging 0.67
R1682:Map3k1 UTSW 13 111757150 missense probably damaging 1.00
R1718:Map3k1 UTSW 13 111755419 missense probably benign 0.23
R1893:Map3k1 UTSW 13 111768033 missense possibly damaging 0.91
R2174:Map3k1 UTSW 13 111752482 missense possibly damaging 0.75
R2215:Map3k1 UTSW 13 111755788 missense probably benign 0.00
R2239:Map3k1 UTSW 13 111748944 missense probably benign 0.00
R3686:Map3k1 UTSW 13 111753891 missense probably damaging 0.99
R3783:Map3k1 UTSW 13 111756220 missense probably benign 0.00
R4094:Map3k1 UTSW 13 111756162 missense possibly damaging 0.48
R4231:Map3k1 UTSW 13 111768494 missense probably benign 0.01
R4902:Map3k1 UTSW 13 111772612 missense probably damaging 0.99
R4967:Map3k1 UTSW 13 111772738 missense probably damaging 0.96
R5465:Map3k1 UTSW 13 111756120 missense probably benign 0.20
R5855:Map3k1 UTSW 13 111755979 missense probably benign 0.37
R6384:Map3k1 UTSW 13 111750530 missense probably damaging 1.00
R6400:Map3k1 UTSW 13 111755725 missense probably damaging 0.99
R6509:Map3k1 UTSW 13 111753829 missense possibly damaging 0.48
R6644:Map3k1 UTSW 13 111752449 missense probably benign 0.07
R6900:Map3k1 UTSW 13 111753816 missense probably benign 0.01
R6943:Map3k1 UTSW 13 111772712 missense probably benign 0.30
R6946:Map3k1 UTSW 13 111768501 nonsense probably null
R7059:Map3k1 UTSW 13 111772778 missense probably benign
R7271:Map3k1 UTSW 13 111756697 missense probably benign 0.32
R7290:Map3k1 UTSW 13 111768111 missense probably damaging 1.00
R7397:Map3k1 UTSW 13 111755208 missense probably damaging 0.98
R7457:Map3k1 UTSW 13 111756255 missense probably damaging 0.99
X0065:Map3k1 UTSW 13 111757105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCATTTCCTAGTACGCAGGC -3'
(R):5'- AAAATGAGTTGTGTCAGGTTTCAGC -3'

Sequencing Primer
(F):5'- TCAGGAAAGAGTTGGGTC -3'
(R):5'- GCTTTCTGGTATGACCGG -3'
Posted On2018-05-04