Incidental Mutation 'R6390:Wdr63'
ID515720
Institutional Source Beutler Lab
Gene Symbol Wdr63
Ensembl Gene ENSMUSG00000043020
Gene NameWD repeat domain 63
Synonyms4931433A13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6390 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146040526-146108130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146095388 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 105 (L105P)
Ref Sequence ENSEMBL: ENSMUSP00000124475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160285]
Predicted Effect probably damaging
Transcript: ENSMUST00000160285
AA Change: L105P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124475
Gene: ENSMUSG00000043020
AA Change: L105P

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
low complexity region 133 150 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
Blast:WD40 321 367 6e-19 BLAST
low complexity region 375 383 N/A INTRINSIC
WD40 390 429 6.34e-2 SMART
WD40 470 527 1.15e-4 SMART
low complexity region 536 553 N/A INTRINSIC
WD40 693 732 1.07e1 SMART
WD40 737 776 1.1e2 SMART
coiled coil region 867 902 N/A INTRINSIC
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,187,981 P113Q probably damaging Het
Ccdc150 A G 1: 54,368,017 D1073G probably benign Het
Cd8a A G 6: 71,373,929 Y126C probably damaging Het
Cdca8 A G 4: 124,936,375 M68T probably damaging Het
Cyp2d26 G A 15: 82,792,624 P174S possibly damaging Het
Esco1 T G 18: 10,567,528 N311H probably damaging Het
Evx1 A G 6: 52,315,857 M183V probably benign Het
Fam111a T G 19: 12,588,160 Y424* probably null Het
Fat4 T C 3: 38,980,380 I2727T probably damaging Het
Ggt6 T A 11: 72,436,611 Y107N possibly damaging Het
Habp2 G C 19: 56,306,823 E49Q possibly damaging Het
Hibadh A C 6: 52,556,489 L214R probably damaging Het
Ift57 T G 16: 49,762,473 probably null Het
Irak4 T C 15: 94,561,486 S328P probably damaging Het
Krtap6-2 A T 16: 89,419,946 Y44* probably null Het
Lrrc46 T C 11: 97,040,931 T22A probably damaging Het
Muc2 G T 7: 141,752,146 V230L probably damaging Het
Ncan T C 8: 70,115,249 D71G probably benign Het
Nsd2 T C 5: 33,881,181 S779P probably damaging Het
Rps6ka5 G T 12: 100,570,992 T493K probably damaging Het
Slc6a21 A T 7: 45,287,002 M135L probably benign Het
Sprtn A G 8: 124,903,219 N417S probably benign Het
Trim61 T A 8: 65,014,190 M140L probably benign Het
Vars C A 17: 35,015,639 A1148E probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r112 T C 17: 22,605,249 V495A probably benign Het
Vmn2r117 A T 17: 23,460,114 V712E possibly damaging Het
Wdfy4 T C 14: 33,104,094 D1200G probably damaging Het
Zbtb6 A T 2: 37,428,678 S413T probably benign Het
Zp2 G T 7: 120,141,230 N170K probably benign Het
Other mutations in Wdr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Wdr63 APN 3 146083004 missense probably benign
IGL00565:Wdr63 APN 3 146044919 splice site probably benign
IGL01339:Wdr63 APN 3 146042836 missense probably benign 0.14
IGL01952:Wdr63 APN 3 146097163 missense probably damaging 0.96
IGL02663:Wdr63 APN 3 146054557 missense possibly damaging 0.53
IGL02710:Wdr63 APN 3 146048148 missense possibly damaging 0.96
P0041:Wdr63 UTSW 3 146081242 missense possibly damaging 0.96
R0014:Wdr63 UTSW 3 146081423 splice site probably null
R0014:Wdr63 UTSW 3 146081423 splice site probably null
R0498:Wdr63 UTSW 3 146081364 missense possibly damaging 0.54
R0589:Wdr63 UTSW 3 146062331 missense probably benign 0.01
R1484:Wdr63 UTSW 3 146097241 missense probably benign 0.02
R1537:Wdr63 UTSW 3 146042749 missense probably damaging 0.98
R1611:Wdr63 UTSW 3 146095358 missense probably damaging 1.00
R1743:Wdr63 UTSW 3 146097262 missense possibly damaging 0.81
R1861:Wdr63 UTSW 3 146083046 missense probably damaging 1.00
R1991:Wdr63 UTSW 3 146063480 missense possibly damaging 0.82
R2185:Wdr63 UTSW 3 146066864 missense possibly damaging 0.76
R4299:Wdr63 UTSW 3 146068806 missense probably damaging 1.00
R4620:Wdr63 UTSW 3 146042809 missense probably damaging 1.00
R4649:Wdr63 UTSW 3 146048167 missense probably damaging 1.00
R4914:Wdr63 UTSW 3 146066827 missense probably damaging 0.98
R4948:Wdr63 UTSW 3 146083065 nonsense probably null
R5578:Wdr63 UTSW 3 146097228 nonsense probably null
R6130:Wdr63 UTSW 3 146042804 missense probably benign 0.25
R6162:Wdr63 UTSW 3 146044862 missense probably damaging 1.00
R6291:Wdr63 UTSW 3 146066893 missense probably benign 0.00
R6560:Wdr63 UTSW 3 146095406 missense possibly damaging 0.79
R6893:Wdr63 UTSW 3 146080429 missense probably damaging 1.00
R7090:Wdr63 UTSW 3 146040827 missense possibly damaging 0.80
R7102:Wdr63 UTSW 3 146055704 missense possibly damaging 0.49
R7111:Wdr63 UTSW 3 146097273 missense probably damaging 0.99
R7260:Wdr63 UTSW 3 146046540 missense probably benign 0.01
R7288:Wdr63 UTSW 3 146081252 missense probably damaging 0.97
R7411:Wdr63 UTSW 3 146097145 missense probably damaging 0.98
R7466:Wdr63 UTSW 3 146055618 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGCATTCTATTTGGGAGAACC -3'
(R):5'- AAAACGTCCATGGCTCCCTTG -3'

Sequencing Primer
(F):5'- TTTGCACAGATTCAGGACGAGC -3'
(R):5'- CCCTTGTGTTCTTACTTTGGGAGC -3'
Posted On2018-05-04