Incidental Mutation 'R6390:Slc6a21'
ID515726
Institutional Source Beutler Lab
Gene Symbol Slc6a21
Ensembl Gene ENSMUSG00000070568
Gene Namesolute carrier family 6 member 21
Synonyms1700039E15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6390 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45277513-45288998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45287002 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 135 (M135L)
Ref Sequence ENSEMBL: ENSMUSP00000082476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085364] [ENSMUST00000210861]
Predicted Effect probably benign
Transcript: ENSMUST00000085364
AA Change: M135L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000082476
Gene: ENSMUSG00000070568
AA Change: M135L

DomainStartEndE-ValueType
Pfam:SNF 1 306 8.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209886
Predicted Effect unknown
Transcript: ENSMUST00000210207
AA Change: M167L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210733
Predicted Effect probably benign
Transcript: ENSMUST00000210861
AA Change: M460L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg9a G T 1: 75,187,981 P113Q probably damaging Het
Ccdc150 A G 1: 54,368,017 D1073G probably benign Het
Cd8a A G 6: 71,373,929 Y126C probably damaging Het
Cdca8 A G 4: 124,936,375 M68T probably damaging Het
Cyp2d26 G A 15: 82,792,624 P174S possibly damaging Het
Esco1 T G 18: 10,567,528 N311H probably damaging Het
Evx1 A G 6: 52,315,857 M183V probably benign Het
Fam111a T G 19: 12,588,160 Y424* probably null Het
Fat4 T C 3: 38,980,380 I2727T probably damaging Het
Ggt6 T A 11: 72,436,611 Y107N possibly damaging Het
Habp2 G C 19: 56,306,823 E49Q possibly damaging Het
Hibadh A C 6: 52,556,489 L214R probably damaging Het
Ift57 T G 16: 49,762,473 probably null Het
Irak4 T C 15: 94,561,486 S328P probably damaging Het
Krtap6-2 A T 16: 89,419,946 Y44* probably null Het
Lrrc46 T C 11: 97,040,931 T22A probably damaging Het
Muc2 G T 7: 141,752,146 V230L probably damaging Het
Ncan T C 8: 70,115,249 D71G probably benign Het
Nsd2 T C 5: 33,881,181 S779P probably damaging Het
Rps6ka5 G T 12: 100,570,992 T493K probably damaging Het
Sprtn A G 8: 124,903,219 N417S probably benign Het
Trim61 T A 8: 65,014,190 M140L probably benign Het
Vars C A 17: 35,015,639 A1148E probably benign Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r112 T C 17: 22,605,249 V495A probably benign Het
Vmn2r117 A T 17: 23,460,114 V712E possibly damaging Het
Wdfy4 T C 14: 33,104,094 D1200G probably damaging Het
Wdr63 A G 3: 146,095,388 L105P probably damaging Het
Zbtb6 A T 2: 37,428,678 S413T probably benign Het
Zp2 G T 7: 120,141,230 N170K probably benign Het
Other mutations in Slc6a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Slc6a21 APN 7 45288244 missense probably benign 0.31
IGL01526:Slc6a21 APN 7 45287796 missense probably damaging 1.00
IGL01670:Slc6a21 APN 7 45288133 missense possibly damaging 0.91
IGL01975:Slc6a21 APN 7 45287851 missense probably benign 0.28
IGL02064:Slc6a21 APN 7 45286459 missense possibly damaging 0.71
IGL02441:Slc6a21 APN 7 45288081 missense probably damaging 1.00
IGL02735:Slc6a21 APN 7 45286637 splice site probably benign
IGL03097:Slc6a21 UTSW 7 45288168 nonsense probably null
R0211:Slc6a21 UTSW 7 45288243 missense possibly damaging 0.90
R0211:Slc6a21 UTSW 7 45288243 missense possibly damaging 0.90
R0269:Slc6a21 UTSW 7 45286908 nonsense probably null
R0336:Slc6a21 UTSW 7 45286468 missense probably damaging 1.00
R1077:Slc6a21 UTSW 7 45288202 missense probably benign 0.42
R1476:Slc6a21 UTSW 7 45272628 missense probably benign 0.09
R1763:Slc6a21 UTSW 7 45287734 nonsense probably null
R1792:Slc6a21 UTSW 7 45280731 missense probably benign 0.04
R1796:Slc6a21 UTSW 7 45280755 missense probably damaging 1.00
R1812:Slc6a21 UTSW 7 45282947 missense probably damaging 1.00
R1868:Slc6a21 UTSW 7 45287828 missense probably benign 0.13
R2121:Slc6a21 UTSW 7 45288462 missense probably benign 0.04
R2129:Slc6a21 UTSW 7 45282773 unclassified probably null
R2294:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R2295:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R2409:Slc6a21 UTSW 7 45280326 missense probably benign 0.15
R2858:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R3498:Slc6a21 UTSW 7 45280842 missense probably damaging 1.00
R3751:Slc6a21 UTSW 7 45280504 missense probably benign
R4297:Slc6a21 UTSW 7 45287762 missense possibly damaging 0.95
R4510:Slc6a21 UTSW 7 45287289 missense probably damaging 1.00
R4511:Slc6a21 UTSW 7 45287289 missense probably damaging 1.00
R4876:Slc6a21 UTSW 7 45280111 nonsense probably null
R4921:Slc6a21 UTSW 7 45288310 missense possibly damaging 0.53
R5485:Slc6a21 UTSW 7 45282542 critical splice donor site probably null
R5559:Slc6a21 UTSW 7 45288429 missense possibly damaging 0.61
R6305:Slc6a21 UTSW 7 45280604 missense possibly damaging 0.88
R6571:Slc6a21 UTSW 7 45280879 missense probably damaging 0.99
R6792:Slc6a21 UTSW 7 45279885 start codon destroyed probably null 0.02
R7235:Slc6a21 UTSW 7 45280758 missense probably damaging 0.99
R7278:Slc6a21 UTSW 7 45282480 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GAAAACGCTGGGTGTCACAG -3'
(R):5'- GGCACACTGGAGTTTGTGAG -3'

Sequencing Primer
(F):5'- GGTGTCACAGTTCTACCCATGAAAG -3'
(R):5'- TGGGATGCTTTGCAAAGG -3'
Posted On2018-05-04