Incidental Mutation 'R6391:Cnga1'
ID515760
Institutional Source Beutler Lab
Gene Symbol Cnga1
Ensembl Gene ENSMUSG00000067220
Gene Namecyclic nucleotide gated channel alpha 1
SynonymsCncg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R6391 (G1)
Quality Score196.009
Status Validated
Chromosome5
Chromosomal Location72603696-72644275 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 72612359 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000126799] [ENSMUST00000169997] [ENSMUST00000201463]
Predicted Effect probably null
Transcript: ENSMUST00000087213
SMART Domains Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000126799
Predicted Effect probably null
Transcript: ENSMUST00000169997
SMART Domains Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 194 388 4.7e-19 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably null
Transcript: ENSMUST00000201463
SMART Domains Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Meta Mutation Damage Score 0.618 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl7b G T 5: 135,180,025 S114I probably damaging Het
Cct8 A T 16: 87,487,678 M207K probably benign Het
Cst13 T C 2: 148,828,191 C94R probably damaging Het
Cyp8b1 G T 9: 121,915,798 S156* probably null Het
Dip2b T C 15: 100,151,276 S184P probably damaging Het
Dmbt1 T C 7: 131,058,254 W516R probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Drosha T A 15: 12,889,717 C890* probably null Het
Eed A G 7: 89,976,941 S75P probably benign Het
Etaa1 A C 11: 17,946,833 I428S probably benign Het
F5 A T 1: 164,193,493 D1179V probably damaging Het
Fat1 T C 8: 44,952,342 V710A possibly damaging Het
Fmo4 G A 1: 162,793,969 Q558* probably null Het
Gm11639 T C 11: 104,994,317 L4134S possibly damaging Het
Gm7361 A G 5: 26,258,962 I72V probably benign Het
Grm4 A G 17: 27,435,320 V552A probably benign Het
Krt13 T A 11: 100,119,376 I260F probably damaging Het
Krtap3-3 T C 11: 99,550,664 D49G probably damaging Het
Lpin1 T C 12: 16,564,553 E409G probably benign Het
Ly9 A G 1: 171,601,008 V238A possibly damaging Het
Map2k6 T C 11: 110,490,877 probably null Het
Mylk2 T C 2: 152,917,395 L362P probably damaging Het
Olfr1225 T A 2: 89,170,598 I205F probably benign Het
Olfr1264 A G 2: 90,021,631 V145A probably benign Het
Olfr575 T A 7: 102,955,415 Y69F possibly damaging Het
Pcdha9 G A 18: 36,997,919 V14M probably benign Het
Pdzrn4 A T 15: 92,680,537 E380D probably damaging Het
Piezo2 A G 18: 63,106,293 Y739H possibly damaging Het
Pigk A G 3: 152,740,849 H195R probably benign Het
Plin2 T C 4: 86,661,999 D175G probably null Het
Plk4 T A 3: 40,808,973 H526Q probably benign Het
Pom121l12 A T 11: 14,599,489 D65V probably damaging Het
Prb1 T C 6: 132,207,176 Y498C unknown Het
Sh3bp2 G A 5: 34,561,603 V495I probably damaging Het
Slx4ip T A 2: 137,046,749 C117S probably damaging Het
Tmtc2 A T 10: 105,573,690 S20R probably benign Het
Unc79 A G 12: 103,021,010 Y186C probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r26 T C 6: 124,061,389 L641P probably damaging Het
Wdr17 A T 8: 54,661,460 S674T probably benign Het
Zfp959 T C 17: 55,895,854 F10L probably damaging Het
Other mutations in Cnga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Cnga1 APN 5 72604486 missense probably damaging 1.00
IGL02345:Cnga1 APN 5 72605272 missense probably benign 0.00
IGL02354:Cnga1 APN 5 72616718 splice site probably null
IGL02361:Cnga1 APN 5 72616718 splice site probably null
IGL03025:Cnga1 APN 5 72605413 missense probably benign
IGL03257:Cnga1 APN 5 72610862 missense probably damaging 1.00
IGL03046:Cnga1 UTSW 5 72604338 missense probably benign 0.01
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0352:Cnga1 UTSW 5 72604503 missense possibly damaging 0.95
R1292:Cnga1 UTSW 5 72604683 missense probably damaging 1.00
R1386:Cnga1 UTSW 5 72612183 nonsense probably null
R1903:Cnga1 UTSW 5 72616725 missense possibly damaging 0.94
R2096:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2097:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2101:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2276:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2279:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2507:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2508:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R3005:Cnga1 UTSW 5 72605107 missense probably damaging 1.00
R3779:Cnga1 UTSW 5 72604783 missense probably damaging 1.00
R4357:Cnga1 UTSW 5 72618252 missense probably damaging 1.00
R4399:Cnga1 UTSW 5 72604381 missense probably damaging 0.98
R4615:Cnga1 UTSW 5 72604774 missense probably damaging 1.00
R4946:Cnga1 UTSW 5 72604764 missense probably damaging 1.00
R5229:Cnga1 UTSW 5 72609500 missense probably damaging 1.00
R5474:Cnga1 UTSW 5 72605193 missense probably damaging 1.00
R5566:Cnga1 UTSW 5 72618250 missense probably damaging 0.98
R5754:Cnga1 UTSW 5 72605272 missense probably benign 0.00
R5899:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R5906:Cnga1 UTSW 5 72610858 missense probably benign 0.19
R5954:Cnga1 UTSW 5 72604878 missense probably damaging 0.99
R5997:Cnga1 UTSW 5 72604575 missense probably damaging 0.98
R6087:Cnga1 UTSW 5 72610812 missense probably damaging 1.00
R6365:Cnga1 UTSW 5 72604945 missense probably benign 0.00
R6525:Cnga1 UTSW 5 72618231 missense probably damaging 1.00
R7046:Cnga1 UTSW 5 72629353 intron probably benign
R7229:Cnga1 UTSW 5 72618249 missense probably benign
R7299:Cnga1 UTSW 5 72605432 missense probably benign 0.20
R7367:Cnga1 UTSW 5 72605358 missense possibly damaging 0.75
R7425:Cnga1 UTSW 5 72609525 missense probably benign 0.12
R7449:Cnga1 UTSW 5 72605304 missense probably benign 0.29
R7538:Cnga1 UTSW 5 72612380 missense probably benign 0.24
X0062:Cnga1 UTSW 5 72604485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGTCGGTTTTCAATGCCAG -3'
(R):5'- GGTTTCTTAGCACTGAGGCAG -3'

Sequencing Primer
(F):5'- CACTTACTCTTCTTTCTTCTCTTTGG -3'
(R):5'- CACTGAGGCAGGACTTTAAATGC -3'
Posted On2018-05-04