Incidental Mutation 'R6392:Sh3pxd2b'
ID515818
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2b
Ensembl Gene ENSMUSG00000040711
Gene NameSH3 and PX domains 2B
SynonymsG431001E03Rik, Fad49, Tsk4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R6392 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location32347820-32428173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32423302 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 823 (L823Q)
Ref Sequence ENSEMBL: ENSMUSP00000044276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038753]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038753
AA Change: L823Q

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711
AA Change: L823Q

DomainStartEndE-ValueType
PX 5 125 2.65e-30 SMART
SH3 155 210 1.11e-14 SMART
SH3 224 279 3.78e-17 SMART
SH3 371 426 2.33e-8 SMART
low complexity region 525 540 N/A INTRINSIC
low complexity region 748 772 N/A INTRINSIC
SH3 850 908 5.75e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik T C 6: 41,032,372 Y176C probably damaging Het
Aars2 A T 17: 45,514,600 I330F probably damaging Het
Abcc9 A G 6: 142,682,099 S402P probably damaging Het
Ada A G 2: 163,728,217 L292P probably damaging Het
Adra1d T C 2: 131,561,609 D187G probably damaging Het
AI467606 C A 7: 127,092,545 Y97* probably null Het
Arid2 A G 15: 96,361,602 E245G probably damaging Het
Ccdc78 C G 17: 25,788,174 Q213E probably damaging Het
Cntnap1 G T 11: 101,186,646 D1045Y probably damaging Het
Ctcf T C 8: 105,664,133 V124A probably damaging Het
Cutc T C 19: 43,760,050 S129P possibly damaging Het
Dhx36 T C 3: 62,494,369 I308V probably benign Het
Disp2 T C 2: 118,790,749 V654A probably damaging Het
Esm1 G A 13: 113,209,749 probably benign Het
Extl1 C T 4: 134,364,634 V303I probably benign Het
Ezh1 G T 11: 101,203,804 D387E probably damaging Het
Fbf1 T A 11: 116,152,949 probably null Het
Fbxl12 T C 9: 20,639,176 H84R probably damaging Het
Fbxo6 C T 4: 148,146,005 V267I probably benign Het
Gm5346 A T 8: 43,626,001 N395K probably benign Het
Helz G T 11: 107,602,341 A197S possibly damaging Het
Ikbke T C 1: 131,275,146 probably null Het
Kbtbd13 A G 9: 65,390,337 F439S possibly damaging Het
Kif7 G A 7: 79,702,186 R943W probably damaging Het
Lrp12 C T 15: 39,872,019 C839Y probably damaging Het
Matr3 A G 18: 35,584,841 D364G probably benign Het
Ncam1 T C 9: 49,523,575 K624E probably damaging Het
Nup205 T C 6: 35,189,885 S280P possibly damaging Het
Olfr1196 A T 2: 88,700,667 Y221N probably damaging Het
Olfr622 A C 7: 103,639,682 C153G probably benign Het
Pira2 A T 7: 3,843,902 S214T possibly damaging Het
Ptpn4 T A 1: 119,773,123 I30F probably benign Het
Rnf144a T C 12: 26,310,780 I253V possibly damaging Het
Sh3rf3 A T 10: 59,007,076 D288V probably damaging Het
Shprh T A 10: 11,178,741 Y1031* probably null Het
Sidt1 T C 16: 44,291,294 T173A possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Ssh3 C T 19: 4,265,371 R309H probably benign Het
Tagap G T 17: 7,934,061 G693W probably damaging Het
Tango2 T A 16: 18,301,539 I143F probably damaging Het
Thsd7a T C 6: 12,468,929 H550R probably damaging Het
Tmem131 T A 1: 36,881,342 Q92H probably benign Het
Tnfrsf21 T C 17: 43,017,088 L31P probably benign Het
Ttn A T 2: 76,900,143 probably benign Het
Ubash3b T C 9: 41,014,972 D493G probably damaging Het
Unc13a C T 8: 71,637,809 G1411D possibly damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfc3h1 A T 10: 115,401,748 R477S probably damaging Het
Zfp87 C T 13: 67,516,867 R492K probably benign Het
Other mutations in Sh3pxd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sh3pxd2b APN 11 32403993 nonsense probably null
IGL01581:Sh3pxd2b APN 11 32387973 missense possibly damaging 0.64
IGL02067:Sh3pxd2b APN 11 32423095 missense probably benign 0.01
IGL02412:Sh3pxd2b APN 11 32387992 missense probably damaging 0.99
IGL02930:Sh3pxd2b APN 11 32417161 missense possibly damaging 0.91
IGL03299:Sh3pxd2b APN 11 32411448 splice site probably benign
IGL03378:Sh3pxd2b APN 11 32381443 missense probably damaging 1.00
FR4449:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423064 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423060 small insertion probably benign
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0441:Sh3pxd2b UTSW 11 32423023 missense possibly damaging 0.77
R0715:Sh3pxd2b UTSW 11 32423341 missense possibly damaging 0.93
R1456:Sh3pxd2b UTSW 11 32415967 missense probably damaging 1.00
R1616:Sh3pxd2b UTSW 11 32381441 missense possibly damaging 0.90
R1748:Sh3pxd2b UTSW 11 32422203 missense possibly damaging 0.92
R1902:Sh3pxd2b UTSW 11 32423559 makesense probably null
R1977:Sh3pxd2b UTSW 11 32422138 missense probably damaging 1.00
R3761:Sh3pxd2b UTSW 11 32422750 missense probably benign 0.45
R3850:Sh3pxd2b UTSW 11 32411505 missense probably damaging 1.00
R4060:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4062:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4064:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4585:Sh3pxd2b UTSW 11 32396479 missense possibly damaging 0.84
R5278:Sh3pxd2b UTSW 11 32381447 missense probably damaging 1.00
R5652:Sh3pxd2b UTSW 11 32422812 missense probably damaging 1.00
R5827:Sh3pxd2b UTSW 11 32422422 missense probably benign 0.01
R5994:Sh3pxd2b UTSW 11 32407570 missense probably damaging 1.00
R6083:Sh3pxd2b UTSW 11 32422985 missense probably benign 0.30
R6625:Sh3pxd2b UTSW 11 32422594 missense possibly damaging 0.74
R6649:Sh3pxd2b UTSW 11 32415978 splice site probably null
R7056:Sh3pxd2b UTSW 11 32422737 missense probably benign 0.01
R7131:Sh3pxd2b UTSW 11 32422072 missense not run
X0017:Sh3pxd2b UTSW 11 32414359 missense possibly damaging 0.94
X0028:Sh3pxd2b UTSW 11 32423110 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTCCAAGAAGCAACCCTG -3'
(R):5'- AAGCTAGGGTTTCTTCCGGAG -3'

Sequencing Primer
(F):5'- CTGCAGCAAAGACCTGTGG -3'
(R):5'- CACTGAGGACCTGGCAGAAC -3'
Posted On2018-05-04