Incidental Mutation 'R6394:Oprl1'
ID515922
Institutional Source Beutler Lab
Gene Symbol Oprl1
Ensembl Gene ENSMUSG00000027584
Gene Nameopioid receptor-like 1
SynonymsORL1, morc, N/OFQ receptor, MOR-C, nociceptin/ orphaninFQ receptor, LC132, XOR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R6394 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location181715016-181720985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 181719002 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 257 (R257C)
Ref Sequence ENSEMBL: ENSMUSP00000104399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071585] [ENSMUST00000108763] [ENSMUST00000108766] [ENSMUST00000108767] [ENSMUST00000108768] [ENSMUST00000148334] [ENSMUST00000183693] [ENSMUST00000184127] [ENSMUST00000184795]
Predicted Effect probably damaging
Transcript: ENSMUST00000071585
AA Change: R257C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071513
Gene: ENSMUSG00000027584
AA Change: R257C

DomainStartEndE-ValueType
Pfam:7tm_4 54 334 5.8e-9 PFAM
Pfam:7TM_GPCR_Srx 56 264 1.4e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 1.4e-62 PFAM
Pfam:7TM_GPCR_Srv 112 332 7.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108763
AA Change: R243C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104394
Gene: ENSMUSG00000027584
AA Change: R243C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 317 6.9e-11 PFAM
Pfam:7tm_1 60 302 1.6e-62 PFAM
Pfam:7TM_GPCR_Srv 91 318 4.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108766
SMART Domains Protein: ENSMUSP00000104397
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 56 189 3.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 59 201 1.8e-9 PFAM
Pfam:7tm_1 65 210 1.6e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108767
AA Change: R257C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104398
Gene: ENSMUSG00000027584
AA Change: R257C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 2.1e-66 PFAM
Pfam:7TM_GPCR_Srv 105 332 7.6e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108768
AA Change: R257C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104399
Gene: ENSMUSG00000027584
AA Change: R257C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 2.1e-66 PFAM
Pfam:7TM_GPCR_Srv 105 332 7.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126835
Predicted Effect probably benign
Transcript: ENSMUST00000148334
SMART Domains Protein: ENSMUSP00000118664
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7tm_1 65 140 5.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151241
Predicted Effect probably benign
Transcript: ENSMUST00000183693
SMART Domains Protein: ENSMUSP00000138810
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 77 1e-3 SMART
PDB:4EA3|B 41 76 9e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184127
SMART Domains Protein: ENSMUSP00000139119
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 76 3e-4 SMART
PDB:4EA3|B 41 76 1e-16 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184795
SMART Domains Protein: ENSMUSP00000138979
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 71 2e-3 SMART
PDB:4EA3|B 41 71 5e-13 PDB
Meta Mutation Damage Score 0.502 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the 7 transmembrane-spanning G protein-coupled receptor family, and functions as a receptor for the endogenous, opioid-related neuropeptide, nociceptin/orphanin FQ. This receptor-ligand system modulates a variety of biological functions and neurobehavior, including stress responses and anxiety behavior, learning and memory, locomotor activity, and inflammatory and immune responses. Alternatively spliced transcript variants have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit altered touch/nociception, facilitation of long-term potentiation and memory, increased dopamine release upon administration of opioid peptide agonist, impaired behavioral response to morphine, and increased susceptibility to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Atp10b A G 11: 43,225,637 Y937C probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn1 A G 6: 42,307,590 T621A possibly damaging Het
Clcn1 A G 6: 42,313,238 T843A possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Jrkl A C 9: 13,245,490 Y55* probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr816 G T 10: 129,911,920 D119E probably damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Pde3a A T 6: 141,487,511 H756L probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rbp2 T A 9: 98,507,820 V95E possibly damaging Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Setd5 T G 6: 113,115,544 V295G probably damaging Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Stxbp5 A T 10: 9,899,231 Y59* probably null Het
Supt6 G A 11: 78,231,065 R254C probably damaging Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Oprl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Oprl1 APN 2 181718511 missense probably damaging 1.00
R0302:Oprl1 UTSW 2 181719228 missense probably benign 0.01
R0453:Oprl1 UTSW 2 181718734 critical splice donor site probably null
R1564:Oprl1 UTSW 2 181718940 missense possibly damaging 0.79
R1618:Oprl1 UTSW 2 181718853 missense probably benign 0.22
R4801:Oprl1 UTSW 2 181719253 missense probably benign
R4802:Oprl1 UTSW 2 181719253 missense probably benign
R5032:Oprl1 UTSW 2 181719002 missense probably damaging 1.00
R5133:Oprl1 UTSW 2 181718610 missense probably damaging 0.99
R5134:Oprl1 UTSW 2 181718610 missense probably damaging 0.99
R6284:Oprl1 UTSW 2 181717991 intron probably benign
R6374:Oprl1 UTSW 2 181715928 missense probably damaging 1.00
R6843:Oprl1 UTSW 2 181715754 missense probably damaging 1.00
R7009:Oprl1 UTSW 2 181718381 missense probably damaging 1.00
X0022:Oprl1 UTSW 2 181715807 missense probably benign 0.28
X0024:Oprl1 UTSW 2 181718548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCAATCAGTTCCCCATGG -3'
(R):5'- TGGGATTGAGACAACTGTTGAC -3'

Sequencing Primer
(F):5'- TGCAGAGATCGAGTGCCTG -3'
(R):5'- GATTGAGACAACTGTTGACATAGCCC -3'
Posted On2018-05-04