Incidental Mutation 'R6394:Clcn1'
ID515928
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R6394 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42307590 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 621 (T621A)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031894
AA Change: T621A

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: T621A

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163235
SMART Domains Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: T549A
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: T549A

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169902
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Atp10b A G 11: 43,225,637 Y937C probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Jrkl A C 9: 13,245,490 Y55* probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr816 G T 10: 129,911,920 D119E probably damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Pde3a A T 6: 141,487,511 H756L probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rbp2 T A 9: 98,507,820 V95E possibly damaging Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Setd5 T G 6: 113,115,544 V295G probably damaging Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Stxbp5 A T 10: 9,899,231 Y59* probably null Het
Supt6 G A 11: 78,231,065 R254C probably damaging Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 unclassified probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCCACACACTTAGTCAATACTG -3'
(R):5'- AGCTCTGAGTTCAAGTCCATACC -3'

Sequencing Primer
(F):5'- CACACACTTAGTCAATACTGTAAGAG -3'
(R):5'- CAGCTGGATTCTGAATCACCTAGG -3'
Posted On2018-05-04