Incidental Mutation 'R6394:Stxbp5'
ID515959
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6394 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 9899231 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 59 (Y59*)
Ref Sequence ENSEMBL: ENSMUSP00000123253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]
Predicted Effect probably null
Transcript: ENSMUST00000038213
AA Change: Y59*
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: Y59*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000125200
AA Change: Y59*
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: Y59*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000141722
AA Change: Y59*
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: Y59*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218800
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Atp10b A G 11: 43,225,637 Y937C probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn1 A G 6: 42,307,590 T621A possibly damaging Het
Clcn1 A G 6: 42,313,238 T843A possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Jrkl A C 9: 13,245,490 Y55* probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr816 G T 10: 129,911,920 D119E probably damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Pde3a A T 6: 141,487,511 H756L probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rbp2 T A 9: 98,507,820 V95E possibly damaging Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Setd5 T G 6: 113,115,544 V295G probably damaging Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Supt6 G A 11: 78,231,065 R254C probably damaging Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9817304 critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9768927 missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9808508 missense probably benign
R5531:Stxbp5 UTSW 10 9762924 nonsense probably null
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9800028 missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9798187 missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9809130 missense possibly damaging 0.93
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGTAGGAACGACTGAGAGCC -3'
(R):5'- TGCCCTCTGTGAAGTTACTAGC -3'

Sequencing Primer
(F):5'- GCCTGCACCACATAATTTCTTATAG -3'
(R):5'- GCTTGTTCCTTAAGATAGAGTCCAC -3'
Posted On2018-05-04