Incidental Mutation 'R6394:Olfr816'
ID515962
Institutional Source Beutler Lab
Gene Symbol Olfr816
Ensembl Gene ENSMUSG00000063715
Gene Nameolfactory receptor 816
SynonymsGA_x6K02T2PULF-11590830-11589892, MOR113-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6394 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129909163-129915597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 129911920 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 119 (D119E)
Ref Sequence ENSEMBL: ENSMUSP00000149515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071605] [ENSMUST00000213438]
Predicted Effect probably damaging
Transcript: ENSMUST00000071605
AA Change: D119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071534
Gene: ENSMUSG00000063715
AA Change: D119E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.9e-50 PFAM
Pfam:7tm_1 39 288 1.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213438
AA Change: D119E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213618
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,792 L174* probably null Het
Akap11 A T 14: 78,522,589 probably null Het
Alpi T A 1: 87,100,706 Y154F possibly damaging Het
Als2 A T 1: 59,167,197 F1635I probably damaging Het
Anxa1 C T 19: 20,383,849 V60M probably damaging Het
Atp10b A G 11: 43,225,637 Y937C probably damaging Het
Brd4 C A 17: 32,224,147 E167* probably null Het
Cacna1h G A 17: 25,387,481 T1048I probably benign Het
Ccdc113 A G 8: 95,557,192 D298G probably benign Het
Cfap100 T A 6: 90,417,623 N74I possibly damaging Het
Chd8 A T 14: 52,202,585 H4Q possibly damaging Het
Clcn1 A G 6: 42,307,590 T621A possibly damaging Het
Clcn1 A G 6: 42,313,238 T843A possibly damaging Het
Clcn3 C T 8: 60,941,291 R68Q probably damaging Het
Dcaf13 T A 15: 39,143,737 N355K probably benign Het
Dnah6 A T 6: 73,155,418 C1100* probably null Het
Dync2h1 A T 9: 7,168,331 V428E probably damaging Het
E230025N22Rik T C 18: 36,686,786 E317G probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Evc2 C A 5: 37,378,275 D431E probably damaging Het
Gcm2 T G 13: 41,109,897 T20P probably damaging Het
Gdf9 A G 11: 53,436,697 Y160C probably damaging Het
Gm8220 A G 14: 44,285,677 probably benign Het
Gm9573 A T 17: 35,620,166 probably benign Het
Gpalpp1 A T 14: 76,107,412 S44T possibly damaging Het
Grip2 T C 6: 91,787,201 Y134C probably damaging Het
Hephl1 A G 9: 15,074,101 F753S probably benign Het
Herc1 A G 9: 66,395,059 T727A probably damaging Het
Herc2 A G 7: 56,215,981 E4232G probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Itga11 T A 9: 62,735,266 probably null Het
Jrkl A C 9: 13,245,490 Y55* probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kif18b A G 11: 102,914,410 V303A probably damaging Het
Klhl29 A T 12: 5,094,830 C423* probably null Het
Klhl29 T C 12: 5,137,720 S215G probably benign Het
Lamp5 A G 2: 136,061,009 D216G possibly damaging Het
Leo1 T A 9: 75,445,470 D98E probably benign Het
Map3k3 T C 11: 106,148,883 V283A probably benign Het
Med12l A G 3: 59,235,087 K902E probably damaging Het
Mmp1b C A 9: 7,386,316 D202Y probably benign Het
Olfr1201 C T 2: 88,794,952 T190I probably benign Het
Olfr239 G A 17: 33,199,513 G155D probably damaging Het
Olfr488 C T 7: 108,255,763 R125H possibly damaging Het
Olfr657 T A 7: 104,635,702 N9K possibly damaging Het
Olfr657 T C 7: 104,636,027 S118P possibly damaging Het
Olfr979 T C 9: 40,000,705 Q174R probably benign Het
Onecut3 A G 10: 80,496,013 I336V probably damaging Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Osbpl6 T C 2: 76,555,954 V207A probably benign Het
Pde3a A T 6: 141,487,511 H756L probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phyh A G 2: 4,936,003 D238G probably benign Het
Pnliprp2 T A 19: 58,761,598 N92K probably benign Het
Pole3 T C 4: 62,524,026 probably benign Het
Ppm1d T C 11: 85,339,672 V372A probably benign Het
Prpf40a A T 2: 53,144,878 I766N probably damaging Het
Prr5 T A 15: 84,699,724 V175E probably damaging Het
Ptprq T A 10: 107,642,943 K1280* probably null Het
Rbp2 T A 9: 98,507,820 V95E possibly damaging Het
Rictor T C 15: 6,769,309 F346L possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Scn10a T A 9: 119,661,320 I519F probably benign Het
Setd5 T G 6: 113,115,544 V295G probably damaging Het
Shcbp1 A T 8: 4,736,176 M642K probably damaging Het
Slc13a3 C T 2: 165,434,097 G243E probably damaging Het
Smg9 T C 7: 24,422,307 Y498H probably damaging Het
Sox5 T C 6: 144,041,313 D175G probably damaging Het
Stard7 A G 2: 127,284,241 D71G probably damaging Het
Stxbp5 A T 10: 9,899,231 Y59* probably null Het
Supt6 G A 11: 78,231,065 R254C probably damaging Het
Syne2 C T 12: 75,990,495 T3817I probably benign Het
Tas2r124 T A 6: 132,755,076 I116N probably damaging Het
Trim9 T A 12: 70,255,213 E550D possibly damaging Het
Vmn2r50 A G 7: 10,040,326 S548P probably damaging Het
Zmynd8 C A 2: 165,846,023 E126* probably null Het
Zswim9 A T 7: 13,260,963 S422R probably damaging Het
Other mutations in Olfr816
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Olfr816 APN 10 129912245 missense possibly damaging 0.89
IGL01650:Olfr816 APN 10 129911681 missense probably benign 0.00
IGL01766:Olfr816 APN 10 129911780 missense probably damaging 1.00
IGL02738:Olfr816 APN 10 129911331 utr 3 prime probably benign
IGL02824:Olfr816 APN 10 129911696 missense probably damaging 1.00
R0401:Olfr816 UTSW 10 129911916 missense probably benign 0.18
R0688:Olfr816 UTSW 10 129911883 missense probably damaging 0.99
R1589:Olfr816 UTSW 10 129911681 missense probably benign 0.00
R1744:Olfr816 UTSW 10 129911393 missense probably damaging 1.00
R2049:Olfr816 UTSW 10 129912167 missense probably benign 0.30
R3763:Olfr816 UTSW 10 129911445 missense probably damaging 1.00
R3952:Olfr816 UTSW 10 129911636 missense probably benign 0.00
R3971:Olfr816 UTSW 10 129911873 missense probably benign 0.01
R4557:Olfr816 UTSW 10 129911529 missense probably damaging 1.00
R5538:Olfr816 UTSW 10 129912002 missense probably benign 0.13
R6127:Olfr816 UTSW 10 129911415 missense probably damaging 1.00
R6227:Olfr816 UTSW 10 129911667 missense probably damaging 1.00
R6707:Olfr816 UTSW 10 129911739 missense probably benign 0.02
R7257:Olfr816 UTSW 10 129912287 start gained probably benign
R7258:Olfr816 UTSW 10 129912287 start gained probably benign
R7260:Olfr816 UTSW 10 129912287 start gained probably benign
R7409:Olfr816 UTSW 10 129912251 missense possibly damaging 0.74
X0019:Olfr816 UTSW 10 129912095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAAGTGGAGTTGTGTCAC -3'
(R):5'- TCACACTCACACTGGTGGATAC -3'

Sequencing Primer
(F):5'- GAGTTGTGTCACAGTAGAAATGATC -3'
(R):5'- GTGGATACTCACCTGAAGACAC -3'
Posted On2018-05-04