Incidental Mutation 'R6397:Cdh1'
ID 516034
Institutional Source Beutler Lab
Gene Symbol Cdh1
Ensembl Gene ENSMUSG00000000303
Gene Name cadherin 1
Synonyms Ecad, E-cadherin, uvomorulin, UM, E-cad, L-CAM
MMRRC Submission 044545-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6397 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 107329983-107396878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107330922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 18 (S18P)
Ref Sequence ENSEMBL: ENSMUSP00000132112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000312] [ENSMUST00000167688]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000000312
AA Change: S18P

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000000312
Gene: ENSMUSG00000000303
AA Change: S18P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 5.3e-11 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 734 881 1.3e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136580
Predicted Effect possibly damaging
Transcript: ENSMUST00000167688
AA Change: S18P

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132112
Gene: ENSMUSG00000000303
AA Change: S18P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 7.1e-10 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 738 880 3.9e-50 PFAM
Meta Mutation Damage Score 0.1362 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 94% (29/31)
MGI Phenotype FUNCTION: This gene encodes E-cadherin, a calcium-dependent cell adhesion molecule that functions in the establishment and maintenance of epithelial cell morphology during embryongenesis and adulthood. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Targeted mutations disrupting binding of calcium to the encoded protein in mice cause death in utero due to failed blastocyst and trophectoderm formation. This gene is located adjacent to a related cadherin gene on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: In mutant homozygotes, adhesive cells of the morula dissociate shortly after initial compaction, probably due to depletion of maternal protein. Mutant embryos fail to form a trophectodermal epithelium or blastocyst cavity, and die near implantation time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef3 G T 10: 18,483,413 (GRCm39) S1437* probably null Het
Dipk1a T A 5: 108,059,504 (GRCm39) K105* probably null Het
Dmbt1 T C 7: 130,705,308 (GRCm39) V1137A possibly damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Gm3486 G A 14: 41,208,343 (GRCm39) L123F probably benign Het
Ifi203 C A 1: 173,754,770 (GRCm39) V654L probably benign Het
Kalrn A G 16: 33,813,355 (GRCm39) L787P probably damaging Het
Kazald1 A G 19: 45,065,317 (GRCm39) E66G probably benign Het
Map4 T A 9: 109,856,784 (GRCm39) D151E possibly damaging Het
Msrb3 G A 10: 120,627,356 (GRCm39) T42I probably damaging Het
Nfatc1 C T 18: 80,679,156 (GRCm39) C744Y probably damaging Het
Nlgn1 T A 3: 25,487,827 (GRCm39) H836L possibly damaging Het
Nrxn2 A G 19: 6,582,152 (GRCm39) N653D probably damaging Het
Oprk1 A G 1: 5,668,971 (GRCm39) Y139C probably damaging Het
Or2ab1 A G 11: 58,488,338 (GRCm39) T39A probably benign Het
Pcdhb5 T A 18: 37,454,558 (GRCm39) S313T probably benign Het
Pcdhb8 C T 18: 37,488,516 (GRCm39) R65* probably null Het
Phf8-ps T C 17: 33,285,219 (GRCm39) N528D probably benign Het
Pstpip2 T G 18: 77,961,079 (GRCm39) C221G probably benign Het
Sall2 T A 14: 52,552,610 (GRCm39) H195L probably damaging Het
Snx7 A G 3: 117,640,272 (GRCm39) I79T probably benign Het
Sptbn2 A T 19: 4,792,446 (GRCm39) E1367V possibly damaging Het
Stau1 A G 2: 166,792,927 (GRCm39) V346A possibly damaging Het
Tchh A G 3: 93,353,173 (GRCm39) E871G unknown Het
Tlr9 A G 9: 106,102,305 (GRCm39) N532S probably damaging Het
Tuba1c G A 15: 98,935,738 (GRCm39) A400T probably benign Het
Vmn2r86 A T 10: 130,282,131 (GRCm39) Y828* probably null Het
Vps45 A G 3: 95,950,164 (GRCm39) I255T probably benign Het
Yap1 T C 9: 8,001,467 (GRCm39) Y173C probably damaging Het
Zc3h7b A T 15: 81,677,055 (GRCm39) I821F probably benign Het
Zftraf1 A T 15: 76,532,391 (GRCm39) I239N probably damaging Het
Other mutations in Cdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Cdh1 APN 8 107,387,516 (GRCm39) missense probably damaging 1.00
IGL01405:Cdh1 APN 8 107,375,633 (GRCm39) missense probably damaging 0.97
IGL01410:Cdh1 APN 8 107,384,485 (GRCm39) missense probably benign 0.19
IGL01901:Cdh1 APN 8 107,384,392 (GRCm39) missense probably damaging 0.99
IGL02197:Cdh1 APN 8 107,380,418 (GRCm39) missense probably benign 0.29
IGL02580:Cdh1 APN 8 107,375,650 (GRCm39) missense probably benign 0.01
IGL02690:Cdh1 APN 8 107,384,516 (GRCm39) missense probably damaging 1.00
IGL02732:Cdh1 APN 8 107,392,955 (GRCm39) missense probably damaging 1.00
IGL02927:Cdh1 APN 8 107,395,143 (GRCm39) missense probably damaging 1.00
R1777:Cdh1 UTSW 8 107,383,467 (GRCm39) missense probably damaging 1.00
R1826:Cdh1 UTSW 8 107,392,898 (GRCm39) missense probably benign 0.03
R1892:Cdh1 UTSW 8 107,390,882 (GRCm39) missense possibly damaging 0.72
R2045:Cdh1 UTSW 8 107,392,814 (GRCm39) splice site probably benign
R2100:Cdh1 UTSW 8 107,386,300 (GRCm39) missense possibly damaging 0.57
R2104:Cdh1 UTSW 8 107,380,391 (GRCm39) splice site probably benign
R2118:Cdh1 UTSW 8 107,390,842 (GRCm39) missense probably benign
R2121:Cdh1 UTSW 8 107,390,842 (GRCm39) missense probably benign
R2124:Cdh1 UTSW 8 107,390,842 (GRCm39) missense probably benign
R2125:Cdh1 UTSW 8 107,383,472 (GRCm39) missense probably damaging 0.99
R2163:Cdh1 UTSW 8 107,375,713 (GRCm39) missense probably benign 0.01
R2165:Cdh1 UTSW 8 107,390,953 (GRCm39) missense probably damaging 1.00
R2266:Cdh1 UTSW 8 107,388,635 (GRCm39) missense probably benign
R2761:Cdh1 UTSW 8 107,380,481 (GRCm39) missense possibly damaging 0.90
R4547:Cdh1 UTSW 8 107,390,535 (GRCm39) missense probably damaging 1.00
R5131:Cdh1 UTSW 8 107,390,430 (GRCm39) missense possibly damaging 0.95
R5767:Cdh1 UTSW 8 107,395,187 (GRCm39) missense probably damaging 0.97
R5931:Cdh1 UTSW 8 107,392,964 (GRCm39) critical splice donor site probably null
R6254:Cdh1 UTSW 8 107,390,430 (GRCm39) missense probably damaging 1.00
R6888:Cdh1 UTSW 8 107,384,946 (GRCm39) missense probably benign 0.09
R6928:Cdh1 UTSW 8 107,387,642 (GRCm39) missense possibly damaging 0.93
R6995:Cdh1 UTSW 8 107,387,545 (GRCm39) missense probably benign 0.02
R7110:Cdh1 UTSW 8 107,395,176 (GRCm39) missense possibly damaging 0.87
R8069:Cdh1 UTSW 8 107,384,405 (GRCm39) missense probably benign 0.26
R8260:Cdh1 UTSW 8 107,330,979 (GRCm39) missense probably benign 0.01
R8387:Cdh1 UTSW 8 107,390,501 (GRCm39) missense probably benign 0.02
R8762:Cdh1 UTSW 8 107,386,336 (GRCm39) missense probably damaging 1.00
R8881:Cdh1 UTSW 8 107,392,904 (GRCm39) missense probably benign 0.00
R8888:Cdh1 UTSW 8 107,330,971 (GRCm39) missense probably damaging 1.00
R8928:Cdh1 UTSW 8 107,392,870 (GRCm39) small deletion probably benign
R8929:Cdh1 UTSW 8 107,392,870 (GRCm39) small deletion probably benign
R8930:Cdh1 UTSW 8 107,392,870 (GRCm39) small deletion probably benign
R8932:Cdh1 UTSW 8 107,392,870 (GRCm39) small deletion probably benign
R9211:Cdh1 UTSW 8 107,390,962 (GRCm39) missense probably benign 0.01
R9472:Cdh1 UTSW 8 107,380,248 (GRCm39) missense probably damaging 1.00
R9649:Cdh1 UTSW 8 107,388,604 (GRCm39) missense possibly damaging 0.87
Z1177:Cdh1 UTSW 8 107,383,471 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTGGACTAGGTTGCCAG -3'
(R):5'- GTAGCACGATTTCTTGGCGC -3'

Sequencing Primer
(F):5'- TGGTGGCCCCAGATGTC -3'
(R):5'- GCGCCTTCACTACCCGAC -3'
Posted On 2018-05-04