Incidental Mutation 'R6398:Ccdc162'
ID516071
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Namecoiled-coil domain containing 162
Synonyms5033413D22Rik
MMRRC Submission 044381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6398 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location41538846-41716634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41627149 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 999 (D999G)
Ref Sequence ENSEMBL: ENSMUSP00000140774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000189488]
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099932
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189488
AA Change: D999G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: D999G

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 T A 4: 126,448,808 Q514L probably benign Het
Alpi G C 1: 87,099,462 T365S probably damaging Het
Cbx4 A T 11: 119,081,082 V489E probably damaging Het
Clspn A G 4: 126,563,947 E88G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ddx1 A T 12: 13,245,720 I33N probably damaging Het
Diaph3 G A 14: 86,866,486 L821F probably damaging Het
Duox2 C T 2: 122,296,370 M221I probably benign Het
Gm15130 A T 2: 111,135,442 M154K unknown Het
Gm3233 G T 10: 77,759,415 probably benign Het
Heg1 A C 16: 33,766,775 I1327L probably damaging Het
Ifnar1 G A 16: 91,505,415 probably null Het
Itpr1 C T 6: 108,505,903 L2310F probably damaging Het
Olfr1450 T C 19: 12,954,317 S243P probably damaging Het
Pcdhb7 A G 18: 37,343,434 N541S possibly damaging Het
Prelp A G 1: 133,914,741 L222P probably damaging Het
Prl8a8 A G 13: 27,508,429 I193T probably damaging Het
Prpf4b G T 13: 34,900,371 R914L probably damaging Het
Ptbp2 G C 3: 119,720,835 Q448E probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Slc9a9 A T 9: 94,670,227 M56L probably benign Het
Slfn4 A G 11: 83,187,174 I263V possibly damaging Het
Taar2 A G 10: 23,941,279 N239S probably benign Het
Trrap T A 5: 144,790,870 I467N possibly damaging Het
Ttc28 T C 5: 111,276,276 Y1439H probably damaging Het
Usp34 A G 11: 23,488,666 I3409M probably benign Het
Zbbx G T 3: 75,078,565 N388K probably damaging Het
Znhit2 A G 19: 6,062,257 N344S probably damaging Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41581339 missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41580306 missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41569887 missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41552388 missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41561155 missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41561127 missense probably damaging 1.00
beeswax UTSW 10 41561226 missense possibly damaging 0.57
honeycomb UTSW 10 41644641 missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41556121 missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41541860 missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41586379 missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41586411 splice site probably benign
R0731:Ccdc162 UTSW 10 41579143 missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41553182 missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41580247 missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41539431 missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41581297 missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41555972 critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41569898 missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41569845 missense probably benign
R2571:Ccdc162 UTSW 10 41552397 missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41655099 missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41561207 start gained probably benign
R2999:Ccdc162 UTSW 10 41580290 missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41539549 splice site probably benign
R3712:Ccdc162 UTSW 10 41587379 missense probably benign
R3736:Ccdc162 UTSW 10 41589568 intron probably null
R4112:Ccdc162 UTSW 10 41656328 missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41587388 missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41681686 missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41673867 missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41553580 splice site probably null
R5155:Ccdc162 UTSW 10 41579151 missense probably damaging 1.00
R5645:Ccdc162 UTSW 10 41552356 missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41569934 missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41556803 nonsense probably null
R5808:Ccdc162 UTSW 10 41655504 missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41561115 missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41561163 missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41634041 missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41630145 nonsense probably null
R6264:Ccdc162 UTSW 10 41694468 missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41663151 missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41694400 missense probably damaging 0.97
R6453:Ccdc162 UTSW 10 41550825 missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41615980 missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41663185 missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41644641 missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41561226 missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41673844 missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41615958 missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41581353 missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41552415 missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41673859 missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41666721 missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41561191 missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41678813 missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41556001 missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41634048 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATGTGTGTATACATTTCCACG -3'
(R):5'- GCTTAATACAGGGCCTGCTC -3'

Sequencing Primer
(F):5'- CACGCTTGTGCATGTAGAAACTC -3'
(R):5'- AGGGCCTGCTCTGGTTCAG -3'
Posted On2018-05-04