Incidental Mutation 'R6399:Trak1'
ID516103
Institutional Source Beutler Lab
Gene Symbol Trak1
Ensembl Gene ENSMUSG00000032536
Gene Nametrafficking protein, kinesin binding 1
Synonymshyrt, 2310001H13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R6399 (G1)
Quality Score111.008
Status Validated
Chromosome9
Chromosomal Location121297502-121474918 bp(+) (GRCm38)
Type of Mutationintron (52 bp from exon)
DNA Base Change (assembly) A to G at 121453496 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439]
Predicted Effect probably null
Transcript: ENSMUST00000045903
SMART Domains Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536

DomainStartEndE-ValueType
Pfam:HAP1_N 47 352 8.1e-139 PFAM
Pfam:Milton 411 580 5e-72 PFAM
low complexity region 882 897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209446
Predicted Effect probably null
Transcript: ENSMUST00000210798
Predicted Effect probably null
Transcript: ENSMUST00000211187
Predicted Effect probably benign
Transcript: ENSMUST00000211301
Predicted Effect probably null
Transcript: ENSMUST00000211439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211699
Meta Mutation Damage Score 0.6376 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency 97% (28/29)
MGI Phenotype PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T C 5: 138,647,559 C569R probably damaging Het
Acadsb T A 7: 131,430,055 W207R probably damaging Het
Apbb2 C T 5: 66,451,467 probably null Het
Atad2b T C 12: 4,957,558 V415A probably damaging Het
Ccdc150 G A 1: 54,263,957 probably null Het
Chd7 A G 4: 8,828,274 T1072A probably damaging Het
Depdc1b T A 13: 108,324,046 F63L probably damaging Het
Dnah2 C T 11: 69,458,518 V2431M probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Flnc A G 6: 29,458,883 E2421G probably damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Kcna4 T C 2: 107,296,549 S543P probably damaging Het
Lrrc30 T A 17: 67,632,686 probably benign Het
Msh6 T A 17: 87,986,891 S1025T probably damaging Het
Ndrg3 C G 2: 156,940,374 A191P probably damaging Het
Olfr259 C T 2: 87,107,986 V134I probably benign Het
Olfr467 A G 7: 107,814,754 T57A possibly damaging Het
Olfr99 T C 17: 37,279,775 Y215C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rnf34 T C 5: 122,861,776 F32L probably benign Het
Serpinb9g A T 13: 33,492,851 L205F probably benign Het
Tbc1d24 T A 17: 24,208,329 I220F probably damaging Het
Thsd7b A T 1: 129,816,648 T758S probably benign Het
Ttn T G 2: 76,726,062 S30200R probably damaging Het
Ttn G C 2: 76,726,063 F30199L probably benign Het
Uggt1 T C 1: 36,163,366 D1050G possibly damaging Het
Veph1 T A 3: 66,125,891 S605C probably benign Het
Wbp1 A G 6: 83,120,001 probably benign Het
Ythdc2 C A 18: 44,886,402 Q1413K possibly damaging Het
Other mutations in Trak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trak1 APN 9 121443736 critical splice donor site probably null
IGL01335:Trak1 APN 9 121454316 missense possibly damaging 0.58
IGL01777:Trak1 APN 9 121431560 splice site probably null
IGL01804:Trak1 APN 9 121442685 splice site probably benign
IGL01986:Trak1 APN 9 121472967 missense probably benign 0.00
IGL02248:Trak1 APN 9 121446794 missense probably damaging 1.00
IGL02276:Trak1 APN 9 121451668 missense probably damaging 1.00
IGL02556:Trak1 APN 9 121448901 missense probably damaging 1.00
IGL03368:Trak1 APN 9 121367122 missense possibly damaging 0.66
PIT4468001:Trak1 UTSW 9 121453332 missense probably benign 0.18
R0067:Trak1 UTSW 9 121472907 missense probably damaging 1.00
R0276:Trak1 UTSW 9 121454338 missense probably damaging 0.97
R0535:Trak1 UTSW 9 121443712 missense probably null 1.00
R0629:Trak1 UTSW 9 121367167 missense probably benign 0.37
R0671:Trak1 UTSW 9 121448955 critical splice donor site probably null
R0883:Trak1 UTSW 9 121453285 missense possibly damaging 0.90
R1160:Trak1 UTSW 9 121392007 missense probably benign 0.01
R1162:Trak1 UTSW 9 121453341 missense possibly damaging 0.93
R1168:Trak1 UTSW 9 121440679 missense probably damaging 1.00
R1398:Trak1 UTSW 9 121454359 missense probably damaging 1.00
R2118:Trak1 UTSW 9 121472997 makesense probably null
R2119:Trak1 UTSW 9 121472997 makesense probably null
R2120:Trak1 UTSW 9 121472997 makesense probably null
R2137:Trak1 UTSW 9 121472962 missense possibly damaging 0.83
R3162:Trak1 UTSW 9 121451734 splice site probably benign
R3888:Trak1 UTSW 9 121442797 splice site probably null
R3889:Trak1 UTSW 9 121445873 missense probably null 0.40
R4031:Trak1 UTSW 9 121451670 missense probably damaging 1.00
R4116:Trak1 UTSW 9 121448843 missense probably damaging 1.00
R4406:Trak1 UTSW 9 121431536 missense probably damaging 1.00
R4630:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4631:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4632:Trak1 UTSW 9 121454425 missense probably benign 0.02
R4786:Trak1 UTSW 9 121472494 missense probably benign 0.25
R5137:Trak1 UTSW 9 121367055 intron probably benign
R5159:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R5467:Trak1 UTSW 9 121446798 missense probably damaging 1.00
R5661:Trak1 UTSW 9 121443637 missense possibly damaging 0.46
R5664:Trak1 UTSW 9 121472307 missense possibly damaging 0.47
R5769:Trak1 UTSW 9 121448838 missense probably damaging 1.00
R6041:Trak1 UTSW 9 121460412 missense probably damaging 0.99
R6257:Trak1 UTSW 9 121446755 missense probably damaging 1.00
R6257:Trak1 UTSW 9 121367224 missense possibly damaging 0.92
R6354:Trak1 UTSW 9 121451726 missense probably null 0.03
R6513:Trak1 UTSW 9 121443756 missense probably benign
R6579:Trak1 UTSW 9 121443638 missense probably benign 0.29
R6940:Trak1 UTSW 9 121443718 missense possibly damaging 0.78
R7120:Trak1 UTSW 9 121460498 missense probably benign
R7304:Trak1 UTSW 9 121416212 missense probably benign
R7396:Trak1 UTSW 9 121448907 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTCTCCCATGAACATCCCGG -3'
(R):5'- CACGGTGATGATCTGTGGGAAATG -3'

Sequencing Primer
(F):5'- ATGAACATCCCGGGCTCC -3'
(R):5'- GGAAATGTGTTAGTTCTCCCTCCATG -3'
Posted On2018-05-04