Mutagenetix > Incidental Mutation

Incidental Mutation 'R6399:Msh6'

516113

Institutional Source

Beutler Lab

Gene Symbol

Msh6

Ensembl Gene

ENSMUSG00000005370

Gene Name

mutS homolog 6

Synonyms

Gtmbp, GTBP, Msh6

MMRRC Submission

044546-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6399 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88282490-88298320 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88294319 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1025 (S1025T)

Ref Sequence

ENSEMBL: ENSMUSP00000005503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005503] [ENSMUST00000005504]

AlphaFold

P54276

Predicted Effect

probably damaging
Transcript: ENSMUST00000005503
AA Change: S1025T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: S1025T

Domain	Start	End	E-Value	Type
low complexity region	23	46	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
PWWP	90	152	9.01e-30	SMART
low complexity region	198	212	N/A	INTRINSIC
low complexity region	216	230	N/A	INTRINSIC
low complexity region	239	264	N/A	INTRINSIC
low complexity region	273	291	N/A	INTRINSIC
low complexity region	373	389	N/A	INTRINSIC
Pfam:MutS_I	406	525	4.7e-35	PFAM
Pfam:MutS_II	536	700	1.4e-10	PFAM
MUTSd	750	1100	4.56e-86	SMART
MUTSac	1125	1319	1.68e-116	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000005504

SMART Domains

Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371

Domain	Start	End	E-Value	Type
low complexity region	2	20	N/A	INTRINSIC
low complexity region	21	73	N/A	INTRINSIC
FBOX	162	202	2.44e-8	SMART
PbH1	398	420	1.37e3	SMART
PbH1	421	443	8.83e0	SMART
CASH	421	557	1.31e-7	SMART
PbH1	444	466	6.15e1	SMART
PbH1	467	489	1.78e3	SMART
PbH1	490	512	2.29e2	SMART
PbH1	513	535	7.67e2	SMART
PbH1	536	558	1.36e0	SMART
PbH1	559	581	3.59e0	SMART
CASH	573	695	2.35e0	SMART
PbH1	582	604	8.73e2	SMART
PbH1	605	627	4.28e2	SMART
PbH1	628	650	5.03e2	SMART
PbH1	651	673	3.79e1	SMART
PbH1	674	696	4.73e0	SMART
PbH1	697	719	1.86e2	SMART
CASH	711	840	9.31e-13	SMART
PbH1	720	742	2.91e0	SMART
PbH1	743	765	3.73e2	SMART
PbH1	766	788	1.62e2	SMART
PbH1	789	811	9.99e1	SMART
PbH1	812	833	1.21e3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130379

SMART Domains

Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371

Domain	Start	End	E-Value	Type
FBOX	87	127	2.44e-8	SMART
PbH1	323	345	1.37e3	SMART
PbH1	346	368	8.83e0	SMART
CASH	346	482	1.31e-7	SMART
PbH1	369	391	6.15e1	SMART
PbH1	392	414	1.78e3	SMART
PbH1	415	437	2.29e2	SMART
PbH1	438	460	7.67e2	SMART
PbH1	461	483	1.36e0	SMART
PbH1	484	506	3.59e0	SMART
CASH	498	620	2.35e0	SMART
PbH1	507	529	8.73e2	SMART
PbH1	530	552	4.28e2	SMART
PbH1	553	575	5.03e2	SMART
PbH1	576	598	3.79e1	SMART
PbH1	599	621	4.73e0	SMART
PbH1	622	644	1.86e2	SMART
CASH	636	765	9.31e-13	SMART
PbH1	645	667	2.91e0	SMART
PbH1	668	690	3.73e2	SMART
PbH1	691	713	1.62e2	SMART
PbH1	714	736	9.99e1	SMART
PbH1	737	758	1.21e3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135639

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 95.7%

Validation Efficiency

97% (28/29)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	T	C	5: 138,645,821 (GRCm39)	C569R	probably damaging	Het
Acadsb	T	A	7: 131,031,784 (GRCm39)	W207R	probably damaging	Het
Apbb2	C	T	5: 66,608,810 (GRCm39)		probably null	Het
Atad2b	T	C	12: 5,007,558 (GRCm39)	V415A	probably damaging	Het
Ccdc150	G	A	1: 54,303,116 (GRCm39)		probably null	Het
Cep20	TTGTG	TTG	16: 14,118,009 (GRCm39)		probably null	Het
Chd7	A	G	4: 8,828,274 (GRCm39)	T1072A	probably damaging	Het
Depdc1b	T	A	13: 108,460,580 (GRCm39)	F63L	probably damaging	Het
Dnah2	C	T	11: 69,349,344 (GRCm39)	V2431M	probably damaging	Het
Dnajc14	A	G	10: 128,643,359 (GRCm39)	E427G	probably damaging	Het
Flnc	A	G	6: 29,458,882 (GRCm39)	E2421G	probably damaging	Het
Kcna4	T	C	2: 107,126,894 (GRCm39)	S543P	probably damaging	Het
Lrrc30	T	A	17: 67,939,681 (GRCm39)		probably benign	Het
Ndrg3	C	G	2: 156,782,294 (GRCm39)	A191P	probably damaging	Het
Or1o4	T	C	17: 37,590,666 (GRCm39)	Y215C	probably damaging	Het
Or5aq7	C	T	2: 86,938,330 (GRCm39)	V134I	probably benign	Het
Or5p5	A	G	7: 107,413,961 (GRCm39)	T57A	possibly damaging	Het
Pls1	A	G	9: 95,636,798 (GRCm39)	I558T	probably damaging	Het
Rnf34	T	C	5: 122,999,839 (GRCm39)	F32L	probably benign	Het
Serpinb9g	A	T	13: 33,676,834 (GRCm39)	L205F	probably benign	Het
Tbc1d24	T	A	17: 24,427,303 (GRCm39)	I220F	probably damaging	Het
Thsd7b	A	T	1: 129,744,385 (GRCm39)	T758S	probably benign	Het
Trak1	A	G	9: 121,282,562 (GRCm39)		probably null	Het
Ttn	G	C	2: 76,556,407 (GRCm39)	F30199L	probably benign	Het
Ttn	T	G	2: 76,556,406 (GRCm39)	S30200R	probably damaging	Het
Uggt1	T	C	1: 36,202,447 (GRCm39)	D1050G	possibly damaging	Het
Veph1	T	A	3: 66,033,312 (GRCm39)	S605C	probably benign	Het
Wbp1	A	G	6: 83,096,982 (GRCm39)		probably benign	Het
Ythdc2	C	A	18: 45,019,469 (GRCm39)	Q1413K	possibly damaging	Het

Other mutations in Msh6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Msh6	APN	17	88,292,907 (GRCm39)	missense	probably benign
IGL01834:Msh6	APN	17	88,293,140 (GRCm39)	missense	probably damaging	1.00
IGL01904:Msh6	APN	17	88,292,160 (GRCm39)	missense	probably benign
IGL01957:Msh6	APN	17	88,292,519 (GRCm39)	missense	possibly damaging	0.73
IGL02117:Msh6	APN	17	88,298,234 (GRCm39)	unclassified	probably benign
IGL02234:Msh6	APN	17	88,294,229 (GRCm39)	missense	probably damaging	1.00
IGL02512:Msh6	APN	17	88,292,160 (GRCm39)	missense	probably benign
IGL02651:Msh6	APN	17	88,296,943 (GRCm39)	missense	probably damaging	1.00
IGL03381:Msh6	APN	17	88,292,537 (GRCm39)	missense	probably damaging	1.00
medea	UTSW	17	88,287,651 (GRCm39)	nonsense	probably null
medusa	UTSW	17	88,295,891 (GRCm39)	unclassified	probably benign
PIT4449001:Msh6	UTSW	17	88,293,616 (GRCm39)	missense	probably damaging	0.96
R0196:Msh6	UTSW	17	88,287,788 (GRCm39)	missense	possibly damaging	0.95
R0324:Msh6	UTSW	17	88,294,048 (GRCm39)	nonsense	probably null
R0492:Msh6	UTSW	17	88,282,679 (GRCm39)	missense	probably benign
R0711:Msh6	UTSW	17	88,294,112 (GRCm39)	missense	probably damaging	1.00
R1065:Msh6	UTSW	17	88,295,891 (GRCm39)	unclassified	probably benign
R1454:Msh6	UTSW	17	88,292,186 (GRCm39)	missense	probably benign	0.00
R1740:Msh6	UTSW	17	88,293,150 (GRCm39)	missense	possibly damaging	0.72
R1770:Msh6	UTSW	17	88,287,651 (GRCm39)	nonsense	probably null
R1771:Msh6	UTSW	17	88,291,950 (GRCm39)	missense	probably benign	0.17
R1919:Msh6	UTSW	17	88,292,553 (GRCm39)	missense	probably benign	0.01
R1926:Msh6	UTSW	17	88,293,653 (GRCm39)	missense	probably benign
R2026:Msh6	UTSW	17	88,297,771 (GRCm39)	missense	probably damaging	1.00
R2095:Msh6	UTSW	17	88,295,661 (GRCm39)	missense	possibly damaging	0.93
R2097:Msh6	UTSW	17	88,292,844 (GRCm39)	missense	probably benign	0.00
R2149:Msh6	UTSW	17	88,293,516 (GRCm39)	missense	probably damaging	1.00
R2156:Msh6	UTSW	17	88,293,568 (GRCm39)	nonsense	probably null
R2167:Msh6	UTSW	17	88,296,911 (GRCm39)	missense	probably damaging	1.00
R2382:Msh6	UTSW	17	88,292,159 (GRCm39)	missense	probably benign
R3005:Msh6	UTSW	17	88,295,713 (GRCm39)	missense	probably benign	0.34
R3160:Msh6	UTSW	17	88,292,909 (GRCm39)	missense	probably damaging	1.00
R3162:Msh6	UTSW	17	88,292,909 (GRCm39)	missense	probably damaging	1.00
R3162:Msh6	UTSW	17	88,292,909 (GRCm39)	missense	probably damaging	1.00
R3774:Msh6	UTSW	17	88,293,609 (GRCm39)	missense	probably damaging	1.00
R3775:Msh6	UTSW	17	88,293,609 (GRCm39)	missense	probably damaging	1.00
R4350:Msh6	UTSW	17	88,292,012 (GRCm39)	missense	probably damaging	1.00
R4424:Msh6	UTSW	17	88,298,217 (GRCm39)	nonsense	probably null
R4499:Msh6	UTSW	17	88,287,697 (GRCm39)	missense	probably damaging	1.00
R4667:Msh6	UTSW	17	88,292,234 (GRCm39)	missense	possibly damaging	0.89
R4668:Msh6	UTSW	17	88,292,234 (GRCm39)	missense	possibly damaging	0.89
R4669:Msh6	UTSW	17	88,292,234 (GRCm39)	missense	possibly damaging	0.89
R4849:Msh6	UTSW	17	88,290,947 (GRCm39)	missense	possibly damaging	0.94
R5137:Msh6	UTSW	17	88,287,716 (GRCm39)	missense	possibly damaging	0.83
R5472:Msh6	UTSW	17	88,291,989 (GRCm39)	missense	possibly damaging	0.81
R5594:Msh6	UTSW	17	88,293,497 (GRCm39)	missense	probably benign	0.00
R5607:Msh6	UTSW	17	88,294,329 (GRCm39)	missense	probably damaging	1.00
R5608:Msh6	UTSW	17	88,294,329 (GRCm39)	missense	probably damaging	1.00
R5660:Msh6	UTSW	17	88,292,147 (GRCm39)	missense	possibly damaging	0.94
R6243:Msh6	UTSW	17	88,290,999 (GRCm39)	missense	possibly damaging	0.69
R6279:Msh6	UTSW	17	88,287,677 (GRCm39)	missense	probably damaging	1.00
R6357:Msh6	UTSW	17	88,291,888 (GRCm39)	nonsense	probably null
R6453:Msh6	UTSW	17	88,293,167 (GRCm39)	missense	probably damaging	1.00
R6646:Msh6	UTSW	17	88,293,870 (GRCm39)	missense	possibly damaging	0.80
R7404:Msh6	UTSW	17	88,282,548 (GRCm39)
R7837:Msh6	UTSW	17	88,292,094 (GRCm39)	missense	probably damaging	1.00
R8004:Msh6	UTSW	17	88,294,215 (GRCm39)	missense	probably damaging	1.00
R8296:Msh6	UTSW	17	88,294,340 (GRCm39)	missense	probably damaging	1.00
R8326:Msh6	UTSW	17	88,294,340 (GRCm39)	missense	probably damaging	1.00
R8377:Msh6	UTSW	17	88,292,598 (GRCm39)	missense	probably damaging	1.00
R8715:Msh6	UTSW	17	88,293,195 (GRCm39)	missense	probably benign
R9752:Msh6	UTSW	17	88,293,963 (GRCm39)	missense	probably damaging	1.00
X0026:Msh6	UTSW	17	88,298,042 (GRCm39)	missense	probably benign	0.00
X0026:Msh6	UTSW	17	88,293,609 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATAGTCTACTGGGGAATCG -3'
(R):5'- CAGGAAATTACCTAGTACCAGTAAGTG -3'

Sequencing Primer
(F):5'- GGTAGGAACCGTTACCAGTTAG -3'
(R):5'- AGTTATTTAAACATCCATGCACACAC -3'

Posted On

2018-05-04