Incidental Mutation 'R6399:Msh6'
ID516113
Institutional Source Beutler Lab
Gene Symbol Msh6
Ensembl Gene ENSMUSG00000005370
Gene NamemutS homolog 6
SynonymsGTBP, Gtmbp, Msh6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6399 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location87975050-87990883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87986891 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1025 (S1025T)
Ref Sequence ENSEMBL: ENSMUSP00000005503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005503] [ENSMUST00000005504]
Predicted Effect probably damaging
Transcript: ENSMUST00000005503
AA Change: S1025T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: S1025T

DomainStartEndE-ValueType
low complexity region 23 46 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
PWWP 90 152 9.01e-30 SMART
low complexity region 198 212 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 373 389 N/A INTRINSIC
Pfam:MutS_I 406 525 4.7e-35 PFAM
Pfam:MutS_II 536 700 1.4e-10 PFAM
MUTSd 750 1100 4.56e-86 SMART
MUTSac 1125 1319 1.68e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000005504
SMART Domains Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 21 73 N/A INTRINSIC
FBOX 162 202 2.44e-8 SMART
PbH1 398 420 1.37e3 SMART
PbH1 421 443 8.83e0 SMART
CASH 421 557 1.31e-7 SMART
PbH1 444 466 6.15e1 SMART
PbH1 467 489 1.78e3 SMART
PbH1 490 512 2.29e2 SMART
PbH1 513 535 7.67e2 SMART
PbH1 536 558 1.36e0 SMART
PbH1 559 581 3.59e0 SMART
CASH 573 695 2.35e0 SMART
PbH1 582 604 8.73e2 SMART
PbH1 605 627 4.28e2 SMART
PbH1 628 650 5.03e2 SMART
PbH1 651 673 3.79e1 SMART
PbH1 674 696 4.73e0 SMART
PbH1 697 719 1.86e2 SMART
CASH 711 840 9.31e-13 SMART
PbH1 720 742 2.91e0 SMART
PbH1 743 765 3.73e2 SMART
PbH1 766 788 1.62e2 SMART
PbH1 789 811 9.99e1 SMART
PbH1 812 833 1.21e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130379
SMART Domains Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371

DomainStartEndE-ValueType
FBOX 87 127 2.44e-8 SMART
PbH1 323 345 1.37e3 SMART
PbH1 346 368 8.83e0 SMART
CASH 346 482 1.31e-7 SMART
PbH1 369 391 6.15e1 SMART
PbH1 392 414 1.78e3 SMART
PbH1 415 437 2.29e2 SMART
PbH1 438 460 7.67e2 SMART
PbH1 461 483 1.36e0 SMART
PbH1 484 506 3.59e0 SMART
CASH 498 620 2.35e0 SMART
PbH1 507 529 8.73e2 SMART
PbH1 530 552 4.28e2 SMART
PbH1 553 575 5.03e2 SMART
PbH1 576 598 3.79e1 SMART
PbH1 599 621 4.73e0 SMART
PbH1 622 644 1.86e2 SMART
CASH 636 765 9.31e-13 SMART
PbH1 645 667 2.91e0 SMART
PbH1 668 690 3.73e2 SMART
PbH1 691 713 1.62e2 SMART
PbH1 714 736 9.99e1 SMART
PbH1 737 758 1.21e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135639
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency 97% (28/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T C 5: 138,647,559 C569R probably damaging Het
Acadsb T A 7: 131,430,055 W207R probably damaging Het
Apbb2 C T 5: 66,451,467 probably null Het
Atad2b T C 12: 4,957,558 V415A probably damaging Het
Ccdc150 G A 1: 54,263,957 probably null Het
Chd7 A G 4: 8,828,274 T1072A probably damaging Het
Depdc1b T A 13: 108,324,046 F63L probably damaging Het
Dnah2 C T 11: 69,458,518 V2431M probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Flnc A G 6: 29,458,883 E2421G probably damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Kcna4 T C 2: 107,296,549 S543P probably damaging Het
Lrrc30 T A 17: 67,632,686 probably benign Het
Ndrg3 C G 2: 156,940,374 A191P probably damaging Het
Olfr259 C T 2: 87,107,986 V134I probably benign Het
Olfr467 A G 7: 107,814,754 T57A possibly damaging Het
Olfr99 T C 17: 37,279,775 Y215C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rnf34 T C 5: 122,861,776 F32L probably benign Het
Serpinb9g A T 13: 33,492,851 L205F probably benign Het
Tbc1d24 T A 17: 24,208,329 I220F probably damaging Het
Thsd7b A T 1: 129,816,648 T758S probably benign Het
Trak1 A G 9: 121,453,496 probably null Het
Ttn T G 2: 76,726,062 S30200R probably damaging Het
Ttn G C 2: 76,726,063 F30199L probably benign Het
Uggt1 T C 1: 36,163,366 D1050G possibly damaging Het
Veph1 T A 3: 66,125,891 S605C probably benign Het
Wbp1 A G 6: 83,120,001 probably benign Het
Ythdc2 C A 18: 44,886,402 Q1413K possibly damaging Het
Other mutations in Msh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Msh6 APN 17 87985479 missense probably benign
IGL01834:Msh6 APN 17 87985712 missense probably damaging 1.00
IGL01904:Msh6 APN 17 87984732 missense probably benign
IGL01957:Msh6 APN 17 87985091 missense possibly damaging 0.73
IGL02117:Msh6 APN 17 87990806 unclassified probably benign
IGL02234:Msh6 APN 17 87986801 missense probably damaging 1.00
IGL02512:Msh6 APN 17 87984732 missense probably benign
IGL02651:Msh6 APN 17 87989515 missense probably damaging 1.00
IGL03381:Msh6 APN 17 87985109 missense probably damaging 1.00
medea UTSW 17 87980223 nonsense probably null
medusa UTSW 17 87988463 unclassified probably benign
PIT4449001:Msh6 UTSW 17 87986188 missense probably damaging 0.96
R0196:Msh6 UTSW 17 87980360 missense possibly damaging 0.95
R0324:Msh6 UTSW 17 87986620 nonsense probably null
R0492:Msh6 UTSW 17 87975251 missense probably benign
R0711:Msh6 UTSW 17 87986684 missense probably damaging 1.00
R1065:Msh6 UTSW 17 87988463 unclassified probably benign
R1454:Msh6 UTSW 17 87984758 missense probably benign 0.00
R1740:Msh6 UTSW 17 87985722 missense possibly damaging 0.72
R1770:Msh6 UTSW 17 87980223 nonsense probably null
R1771:Msh6 UTSW 17 87984522 missense probably benign 0.17
R1919:Msh6 UTSW 17 87985125 missense probably benign 0.01
R1926:Msh6 UTSW 17 87986225 missense probably benign
R2026:Msh6 UTSW 17 87990343 missense probably damaging 1.00
R2095:Msh6 UTSW 17 87988233 missense possibly damaging 0.93
R2097:Msh6 UTSW 17 87985416 missense probably benign 0.00
R2149:Msh6 UTSW 17 87986088 missense probably damaging 1.00
R2156:Msh6 UTSW 17 87986140 nonsense probably null
R2167:Msh6 UTSW 17 87989483 missense probably damaging 1.00
R2382:Msh6 UTSW 17 87984731 missense probably benign
R3005:Msh6 UTSW 17 87988285 missense probably benign 0.34
R3160:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3162:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3162:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3774:Msh6 UTSW 17 87986181 missense probably damaging 1.00
R3775:Msh6 UTSW 17 87986181 missense probably damaging 1.00
R4350:Msh6 UTSW 17 87984584 missense probably damaging 1.00
R4424:Msh6 UTSW 17 87990789 nonsense probably null
R4499:Msh6 UTSW 17 87980269 missense probably damaging 1.00
R4667:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4668:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4669:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4849:Msh6 UTSW 17 87983519 missense possibly damaging 0.94
R5137:Msh6 UTSW 17 87980288 missense possibly damaging 0.83
R5472:Msh6 UTSW 17 87984561 missense possibly damaging 0.81
R5594:Msh6 UTSW 17 87986069 missense probably benign 0.00
R5607:Msh6 UTSW 17 87986901 missense probably damaging 1.00
R5608:Msh6 UTSW 17 87986901 missense probably damaging 1.00
R5660:Msh6 UTSW 17 87984719 missense possibly damaging 0.94
R6243:Msh6 UTSW 17 87983571 missense possibly damaging 0.69
R6279:Msh6 UTSW 17 87980249 missense probably damaging 1.00
R6357:Msh6 UTSW 17 87984460 nonsense probably null
R6453:Msh6 UTSW 17 87985739 missense probably damaging 1.00
R6646:Msh6 UTSW 17 87986442 missense possibly damaging 0.80
X0026:Msh6 UTSW 17 87986181 missense probably damaging 1.00
X0026:Msh6 UTSW 17 87990614 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATAGTCTACTGGGGAATCG -3'
(R):5'- CAGGAAATTACCTAGTACCAGTAAGTG -3'

Sequencing Primer
(F):5'- GGTAGGAACCGTTACCAGTTAG -3'
(R):5'- AGTTATTTAAACATCCATGCACACAC -3'
Posted On2018-05-04