Incidental Mutation 'R6400:Nbr1'
ID516136
Institutional Source Beutler Lab
Gene Symbol Nbr1
Ensembl Gene ENSMUSG00000017119
Gene Nameneighbor of Brca1 gene 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6400 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101552149-101581951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101565774 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 159 (L159P)
Ref Sequence ENSEMBL: ENSMUSP00000133619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071537] [ENSMUST00000103098] [ENSMUST00000103099] [ENSMUST00000107208] [ENSMUST00000107212] [ENSMUST00000107213] [ENSMUST00000107218] [ENSMUST00000123558]
Predicted Effect probably damaging
Transcript: ENSMUST00000071537
AA Change: L159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071467
Gene: ENSMUSG00000017119
AA Change: L159P

DomainStartEndE-ValueType
PB1 4 86 2.05e-8 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
Pfam:N_BRCA1_IG 378 479 7.1e-34 PFAM
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000103098
AA Change: L159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099387
Gene: ENSMUSG00000017119
AA Change: L159P

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000103099
AA Change: L159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099388
Gene: ENSMUSG00000017119
AA Change: L159P

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107208
AA Change: L159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102826
Gene: ENSMUSG00000017119
AA Change: L159P

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 1e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107212
AA Change: L159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102830
Gene: ENSMUSG00000017119
AA Change: L159P

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 3e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 689 719 N/A INTRINSIC
PDB:2MJ5|B 910 956 2e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107213
AA Change: L159P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102831
Gene: ENSMUSG00000017119
AA Change: L159P

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 677 707 N/A INTRINSIC
PDB:2MJ5|B 898 944 2e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107218
AA Change: L159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102836
Gene: ENSMUSG00000017119
AA Change: L159P

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000123558
AA Change: L159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133619
Gene: ENSMUSG00000017119
AA Change: L159P

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146452
Predicted Effect probably benign
Transcript: ENSMUST00000149019
SMART Domains Protein: ENSMUSP00000119900
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
coiled coil region 50 89 N/A INTRINSIC
Pfam:N_BRCA1_IG 138 239 2.3e-34 PFAM
low complexity region 267 278 N/A INTRINSIC
coiled coil region 473 500 N/A INTRINSIC
PDB:2MJ5|B 659 705 1e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174013
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was originally identified as an ovarian tumor antigen monitored in ovarian cancer. The encoded protein contains a B-box/coiled-coil motif, which is present in many genes with transformation potential. It functions as a specific autophagy receptor for the selective autophagic degradation of peroxisomes by forming intracellular inclusions with ubiquitylated autophagic substrates. This gene is located on a region of chromosome 17q21.1 that is in close proximity to the BRCA1 tumor suppressor gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous mice of the genetic truncation allele had an age-dependent increase in bone mass and bone mineral density. Mice homozygous for a floxed allele activated in T cells exhibit decreased ovalbumin-induced inflammation and defective Th2 polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,692,709 *160Q probably null Het
Aen G A 7: 78,907,394 G330E probably benign Het
Akap8l G A 17: 32,336,320 R262C probably damaging Het
Cbx8 G A 11: 119,038,868 Q300* probably null Het
Cd274 C T 19: 29,385,408 T290M probably damaging Het
Cd36 A C 5: 17,814,723 S127A probably damaging Het
Celf3 A G 3: 94,480,286 Y55C probably damaging Het
Clec1a A T 6: 129,435,353 probably null Het
Cog2 A T 8: 124,550,306 I684F probably damaging Het
Cyp2c65 C T 19: 39,061,114 L29F possibly damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Dytn A T 1: 63,641,176 L408* probably null Het
Flg A G 3: 93,279,921 T227A probably benign Het
Heatr4 T A 12: 83,955,010 K887M probably null Het
Hoxb1 C T 11: 96,365,992 Q56* probably null Het
Kcnh7 T A 2: 62,739,344 N736I probably damaging Het
Lgr4 T C 2: 109,991,133 V120A probably damaging Het
Ltbp1 A G 17: 75,151,402 Y326C possibly damaging Het
Map3k1 A T 13: 111,755,725 S999T probably damaging Het
Med12l T C 3: 59,247,911 F1171L probably damaging Het
Muc5b T C 7: 141,858,665 S1783P unknown Het
Nme9 T C 9: 99,469,707 F248S possibly damaging Het
Olfr1265 C T 2: 90,037,395 L159F probably benign Het
Olfr420 T C 1: 174,159,264 S164P probably damaging Het
Rasgrf1 C T 9: 89,991,630 T664I probably damaging Het
Setx A G 2: 29,130,274 D91G probably damaging Het
Stim1 A G 7: 102,430,950 R514G probably null Het
Svep1 C A 4: 58,049,169 G3446V probably damaging Het
Tcte2 T A 17: 13,722,452 probably benign Het
Trmt10b A G 4: 45,308,562 K239E probably damaging Het
Wdr70 A T 15: 8,042,841 S189T probably benign Het
Other mutations in Nbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Nbr1 APN 11 101569359 missense possibly damaging 0.91
IGL02192:Nbr1 APN 11 101569591 missense probably damaging 1.00
IGL02259:Nbr1 APN 11 101577990 missense probably damaging 0.99
IGL02951:Nbr1 APN 11 101571979 critical splice donor site probably null
IGL02994:Nbr1 APN 11 101556227 missense probably damaging 1.00
R0087:Nbr1 UTSW 11 101564693 missense probably benign 0.16
R0630:Nbr1 UTSW 11 101567087 unclassified probably benign
R0723:Nbr1 UTSW 11 101576319 nonsense probably null
R0733:Nbr1 UTSW 11 101576371 missense probably benign 0.00
R1482:Nbr1 UTSW 11 101572841 missense probably benign 0.34
R1567:Nbr1 UTSW 11 101575211 missense probably damaging 0.98
R1570:Nbr1 UTSW 11 101564830 unclassified probably benign
R1668:Nbr1 UTSW 11 101569766 missense probably benign 0.00
R1759:Nbr1 UTSW 11 101559543 missense probably damaging 1.00
R1903:Nbr1 UTSW 11 101575152 missense probably damaging 0.98
R1927:Nbr1 UTSW 11 101567214 missense possibly damaging 0.78
R2131:Nbr1 UTSW 11 101566191 unclassified probably null
R2211:Nbr1 UTSW 11 101567264 critical splice donor site probably null
R2255:Nbr1 UTSW 11 101572817 missense possibly damaging 0.80
R4270:Nbr1 UTSW 11 101567222 missense possibly damaging 0.87
R4271:Nbr1 UTSW 11 101567222 missense possibly damaging 0.87
R4710:Nbr1 UTSW 11 101575275 missense probably damaging 1.00
R4947:Nbr1 UTSW 11 101575077 missense probably benign 0.06
R5468:Nbr1 UTSW 11 101572464 missense probably benign 0.10
R5554:Nbr1 UTSW 11 101564807 missense probably benign 0.34
R5771:Nbr1 UTSW 11 101559538 missense probably damaging 1.00
R6119:Nbr1 UTSW 11 101567112 unclassified probably null
R6603:Nbr1 UTSW 11 101556105 unclassified probably benign
R6943:Nbr1 UTSW 11 101577951 missense probably damaging 1.00
R7347:Nbr1 UTSW 11 101569321 nonsense probably null
R7472:Nbr1 UTSW 11 101571939 missense probably damaging 1.00
R7501:Nbr1 UTSW 11 101566200 missense probably damaging 1.00
X0019:Nbr1 UTSW 11 101567124 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GAAACTAGCAGCCTTGATTTACTTC -3'
(R):5'- GTCAACTTTTATGATGCTTCAGGC -3'

Sequencing Primer
(F):5'- TTGATTTACTTCAAGAGAAAGGGAAG -3'
(R):5'- AGGCAGGTTAGAACTTCCTTCAC -3'
Posted On2018-05-04