Incidental Mutation 'R6401:Ifi209'
ID516148
Institutional Source Beutler Lab
Gene Symbol Ifi209
Ensembl Gene ENSMUSG00000043263
Gene Nameinterferon activated gene 209
SynonymsIfix, Pyhin1, Pyhin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6401 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173630917-173647928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173644703 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 370 (M370T)
Ref Sequence ENSEMBL: ENSMUSP00000061900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056071] [ENSMUST00000193727]
Predicted Effect probably damaging
Transcript: ENSMUST00000056071
AA Change: M370T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061900
Gene: ENSMUSG00000043263
AA Change: M370T

DomainStartEndE-ValueType
PYRIN 6 83 3.54e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Pfam:HIN 231 396 4.2e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193727
SMART Domains Protein: ENSMUSP00000142161
Gene: ENSMUSG00000043263

DomainStartEndE-ValueType
PYRIN 6 83 1.7e-21 SMART
low complexity region 152 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200598
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 93% (41/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano3 T A 2: 110,775,114 N249I probably benign Het
Ap3s1 A C 18: 46,758,007 I56L probably benign Het
Cngb1 A G 8: 95,303,739 probably benign Het
Col2a1 T C 15: 97,985,892 T570A unknown Het
Cyp3a16 T C 5: 145,440,364 E471G probably damaging Het
D930020B18Rik A G 10: 121,641,857 N14D possibly damaging Het
Ext1 T C 15: 53,106,097 E365G possibly damaging Het
Fbn1 C A 2: 125,346,450 V1490F probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4869 A T 5: 140,456,943 T80S possibly damaging Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Ighv2-4 G T 12: 113,653,462 P60Q probably damaging Het
Ldb3 A T 14: 34,577,334 L111Q probably benign Het
Mcmbp G T 7: 128,707,059 L413I possibly damaging Het
Mib1 T A 18: 10,795,802 M721K probably benign Het
Nos3 A G 5: 24,379,811 T738A probably benign Het
Notch3 T A 17: 32,158,623 I160L probably benign Het
Nrxn3 C A 12: 89,255,000 N516K possibly damaging Het
Nt5c2 A G 19: 46,889,811 Y496H probably benign Het
Olfr1465 T C 19: 13,313,514 Y257C probably damaging Het
Olfr275 A C 4: 52,826,242 T282P probably damaging Het
Olfr351 A T 2: 36,860,165 L61* probably null Het
Polm A T 11: 5,829,491 W436R probably damaging Het
Prex2 T A 1: 11,186,727 I1221N probably benign Het
Rfpl4b T C 10: 38,820,945 H220R possibly damaging Het
Rgs12 T C 5: 35,020,332 F79L probably damaging Het
Rxfp2 A G 5: 150,043,130 D111G probably benign Het
Smg7 A G 1: 152,840,136 probably null Het
Spata22 T C 11: 73,333,354 S34P probably damaging Het
St7 T A 6: 17,855,318 probably null Het
Stk31 A G 6: 49,423,438 E399G probably damaging Het
Tcp10b C A 17: 13,073,579 N296K probably damaging Het
Tonsl T C 15: 76,633,666 Y645C probably damaging Het
Ttn A T 2: 76,969,862 M334K probably benign Het
Vcpkmt C A 12: 69,582,845 V48F probably damaging Het
Vmn2r112 T A 17: 22,603,551 Y403* probably null Het
Vwa7 G A 17: 35,017,310 probably null Het
Wisp2 T C 2: 163,829,026 I151T probably benign Het
Wscd2 A T 5: 113,588,145 *572C probably null Het
Xpo7 A G 14: 70,682,347 L676P probably damaging Het
Zbtb32 A C 7: 30,591,819 L17W probably damaging Het
Other mutations in Ifi209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ifi209 APN 1 173638963 missense possibly damaging 0.88
IGL02598:Ifi209 APN 1 173644715 missense probably damaging 0.99
IGL02712:Ifi209 APN 1 173642701 missense possibly damaging 0.68
IGL03131:Ifi209 APN 1 173641234 missense possibly damaging 0.86
IGL03368:Ifi209 APN 1 173642491 missense possibly damaging 0.91
R0880:Ifi209 UTSW 1 173644813 missense probably damaging 1.00
R1317:Ifi209 UTSW 1 173637463 missense possibly damaging 0.96
R1640:Ifi209 UTSW 1 173637365 missense probably damaging 0.98
R1769:Ifi209 UTSW 1 173641162 missense probably benign 0.11
R2349:Ifi209 UTSW 1 173642556 missense probably damaging 1.00
R5096:Ifi209 UTSW 1 173644734 missense probably benign 0.17
R5369:Ifi209 UTSW 1 173637307 start codon destroyed probably null 1.00
R5484:Ifi209 UTSW 1 173641074 missense probably benign 0.18
R5532:Ifi209 UTSW 1 173638976 missense probably damaging 0.99
R5551:Ifi209 UTSW 1 173641197 missense probably benign 0.01
R5554:Ifi209 UTSW 1 173641197 missense probably benign 0.01
R5749:Ifi209 UTSW 1 173637327 missense probably damaging 1.00
R5960:Ifi209 UTSW 1 173638816 intron probably null
R7042:Ifi209 UTSW 1 173642670 missense probably benign 0.34
R7304:Ifi209 UTSW 1 173642590 missense possibly damaging 0.88
Z1088:Ifi209 UTSW 1 173637407 missense probably damaging 0.99
Z1088:Ifi209 UTSW 1 173641146 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCAGGATTTGCAACCCAGAATC -3'
(R):5'- TCCTGAAAGCATGACCCTTG -3'

Sequencing Primer
(F):5'- GCAACCCAGAATCTGTTTTGC -3'
(R):5'- CTGAAAGCATGACCCTTGGGAAG -3'
Posted On2018-05-04