Incidental Mutation 'R6401:Ano3'
ID516152
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Nameanoctamin 3
SynonymsTmem16c, B230324K02Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6401 (G1)
Quality Score170.009
Status Validated
Chromosome2
Chromosomal Location110655201-110950923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110775114 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 249 (N249I)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
Predicted Effect probably benign
Transcript: ENSMUST00000099623
AA Change: N249I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: N249I

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111019
SMART Domains Protein: ENSMUSP00000106648
Gene: ENSMUSG00000074968

DomainStartEndE-ValueType
Pfam:Anoctamin 384 627 6.3e-60 PFAM
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3s1 A C 18: 46,758,007 I56L probably benign Het
Cngb1 A G 8: 95,303,739 probably benign Het
Col2a1 T C 15: 97,985,892 T570A unknown Het
Cyp3a16 T C 5: 145,440,364 E471G probably damaging Het
D930020B18Rik A G 10: 121,641,857 N14D possibly damaging Het
Ext1 T C 15: 53,106,097 E365G possibly damaging Het
Fbn1 C A 2: 125,346,450 V1490F probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4869 A T 5: 140,456,943 T80S possibly damaging Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Ifi209 T C 1: 173,644,703 M370T probably damaging Het
Ighv2-4 G T 12: 113,653,462 P60Q probably damaging Het
Ldb3 A T 14: 34,577,334 L111Q probably benign Het
Mcmbp G T 7: 128,707,059 L413I possibly damaging Het
Mib1 T A 18: 10,795,802 M721K probably benign Het
Nos3 A G 5: 24,379,811 T738A probably benign Het
Notch3 T A 17: 32,158,623 I160L probably benign Het
Nrxn3 C A 12: 89,255,000 N516K possibly damaging Het
Nt5c2 A G 19: 46,889,811 Y496H probably benign Het
Olfr1465 T C 19: 13,313,514 Y257C probably damaging Het
Olfr275 A C 4: 52,826,242 T282P probably damaging Het
Olfr351 A T 2: 36,860,165 L61* probably null Het
Polm A T 11: 5,829,491 W436R probably damaging Het
Prex2 T A 1: 11,186,727 I1221N probably benign Het
Rfpl4b T C 10: 38,820,945 H220R possibly damaging Het
Rgs12 T C 5: 35,020,332 F79L probably damaging Het
Rxfp2 A G 5: 150,043,130 D111G probably benign Het
Smg7 A G 1: 152,840,136 probably null Het
Spata22 T C 11: 73,333,354 S34P probably damaging Het
St7 T A 6: 17,855,318 probably null Het
Stk31 A G 6: 49,423,438 E399G probably damaging Het
Tcp10b C A 17: 13,073,579 N296K probably damaging Het
Tonsl T C 15: 76,633,666 Y645C probably damaging Het
Ttn A T 2: 76,969,862 M334K probably benign Het
Vcpkmt C A 12: 69,582,845 V48F probably damaging Het
Vmn2r112 T A 17: 22,603,551 Y403* probably null Het
Vwa7 G A 17: 35,017,310 probably null Het
Wisp2 T C 2: 163,829,026 I151T probably benign Het
Wscd2 A T 5: 113,588,145 *572C probably null Het
Xpo7 A G 14: 70,682,347 L676P probably damaging Het
Zbtb32 A C 7: 30,591,819 L17W probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 unclassified probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 intron probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCTTTTACAAATAAGCTCAGGAA -3'
(R):5'- GTGCATTCCTGTTTGTACATATTTAGG -3'

Sequencing Primer
(F):5'- AGGGTCCAGTATAGCAGT -3'
(R):5'- TGTGCAAATATGTGTGCATGAG -3'
Posted On2018-05-04