Incidental Mutation 'R6401:Olfr275'
ID516155
Institutional Source Beutler Lab
Gene Symbol Olfr275
Ensembl Gene ENSMUSG00000089717
Gene Nameolfactory receptor 275
SynonymsGA_x6K02T2N78B-7168533-7167574, MOR262-2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_146858.2; MGI: 3030109

Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6401 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location52814604-52828269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 52826242 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 282 (T282P)
Ref Sequence ENSEMBL: ENSMUSP00000092700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095085]
Predicted Effect probably damaging
Transcript: ENSMUST00000095085
AA Change: T282P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092700
Gene: ENSMUSG00000089717
AA Change: T282P

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 9.8e-54 PFAM
Pfam:7tm_1 41 290 6.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219705
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano3 T A 2: 110,775,114 N249I probably benign Het
Ap3s1 A C 18: 46,758,007 I56L probably benign Het
Cngb1 A G 8: 95,303,739 probably benign Het
Col2a1 T C 15: 97,985,892 T570A unknown Het
Cyp3a16 T C 5: 145,440,364 E471G probably damaging Het
D930020B18Rik A G 10: 121,641,857 N14D possibly damaging Het
Ext1 T C 15: 53,106,097 E365G possibly damaging Het
Fbn1 C A 2: 125,346,450 V1490F probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4869 A T 5: 140,456,943 T80S possibly damaging Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Ifi209 T C 1: 173,644,703 M370T probably damaging Het
Ighv2-4 G T 12: 113,653,462 P60Q probably damaging Het
Ldb3 A T 14: 34,577,334 L111Q probably benign Het
Mcmbp G T 7: 128,707,059 L413I possibly damaging Het
Mib1 T A 18: 10,795,802 M721K probably benign Het
Nos3 A G 5: 24,379,811 T738A probably benign Het
Notch3 T A 17: 32,158,623 I160L probably benign Het
Nrxn3 C A 12: 89,255,000 N516K possibly damaging Het
Nt5c2 A G 19: 46,889,811 Y496H probably benign Het
Olfr1465 T C 19: 13,313,514 Y257C probably damaging Het
Olfr351 A T 2: 36,860,165 L61* probably null Het
Polm A T 11: 5,829,491 W436R probably damaging Het
Prex2 T A 1: 11,186,727 I1221N probably benign Het
Rfpl4b T C 10: 38,820,945 H220R possibly damaging Het
Rgs12 T C 5: 35,020,332 F79L probably damaging Het
Rxfp2 A G 5: 150,043,130 D111G probably benign Het
Smg7 A G 1: 152,840,136 probably null Het
Spata22 T C 11: 73,333,354 S34P probably damaging Het
St7 T A 6: 17,855,318 probably null Het
Stk31 A G 6: 49,423,438 E399G probably damaging Het
Tcp10b C A 17: 13,073,579 N296K probably damaging Het
Tonsl T C 15: 76,633,666 Y645C probably damaging Het
Ttn A T 2: 76,969,862 M334K probably benign Het
Vcpkmt C A 12: 69,582,845 V48F probably damaging Het
Vmn2r112 T A 17: 22,603,551 Y403* probably null Het
Vwa7 G A 17: 35,017,310 probably null Het
Wisp2 T C 2: 163,829,026 I151T probably benign Het
Wscd2 A T 5: 113,588,145 *572C probably null Het
Xpo7 A G 14: 70,682,347 L676P probably damaging Het
Zbtb32 A C 7: 30,591,819 L17W probably damaging Het
Other mutations in Olfr275
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Olfr275 APN 4 52825727 missense probably damaging 1.00
IGL01758:Olfr275 APN 4 52825468 nonsense probably null
IGL01925:Olfr275 APN 4 52825910 missense probably benign 0.00
IGL02525:Olfr275 APN 4 52825616 missense probably damaging 1.00
IGL02536:Olfr275 APN 4 52825817 missense possibly damaging 0.95
IGL02829:Olfr275 APN 4 52826027 missense probably damaging 0.98
R0068:Olfr275 UTSW 4 52825503 nonsense probably null
R0068:Olfr275 UTSW 4 52825503 nonsense probably null
R0190:Olfr275 UTSW 4 52825613 missense probably damaging 0.97
R4376:Olfr275 UTSW 4 52826195 missense possibly damaging 0.81
R4617:Olfr275 UTSW 4 52825399 start codon destroyed probably benign 0.35
R4658:Olfr275 UTSW 4 52826240 missense probably damaging 0.99
R4828:Olfr275 UTSW 4 52826138 missense probably damaging 1.00
R4850:Olfr275 UTSW 4 52825450 missense possibly damaging 0.94
R6194:Olfr275 UTSW 4 52825779 nonsense probably null
R6842:Olfr275 UTSW 4 52825576 missense probably damaging 1.00
R7033:Olfr275 UTSW 4 52826089 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGAGGATCAGCTCAATGGATG -3'
(R):5'- AGACAGTGAGATCATTTAGTAGGTC -3'

Sequencing Primer
(F):5'- TGGCCGAAGCAAAGCCTTTTC -3'
(R):5'- AAATTAGTGTTTTCTGGGAAATTGGC -3'
Posted On2018-05-04