Incidental Mutation 'R6401:Or13f5'
ID 516155
Institutional Source Beutler Lab
Gene Symbol Or13f5
Ensembl Gene ENSMUSG00000089717
Gene Name olfactory receptor family 13 subfamily F member 5
Synonyms GA_x6K02T2N78B-7168533-7167574, Olfr275, MOR262-2
MMRRC Submission 044548-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R6401 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 52825399-52826358 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 52826242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 282 (T282P)
Ref Sequence ENSEMBL: ENSMUSP00000092700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095085]
AlphaFold Q7TS18
Predicted Effect probably damaging
Transcript: ENSMUST00000095085
AA Change: T282P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092700
Gene: ENSMUSG00000089717
AA Change: T282P

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 9.8e-54 PFAM
Pfam:7tm_1 41 290 6.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219705
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano3 T A 2: 110,605,459 (GRCm39) N249I probably benign Het
Ap3s1 A C 18: 46,891,074 (GRCm39) I56L probably benign Het
Ccn5 T C 2: 163,670,946 (GRCm39) I151T probably benign Het
Cngb1 A G 8: 96,030,367 (GRCm39) probably benign Het
Col2a1 T C 15: 97,883,773 (GRCm39) T570A unknown Het
Cyp3a16 T C 5: 145,377,174 (GRCm39) E471G probably damaging Het
D930020B18Rik A G 10: 121,477,762 (GRCm39) N14D possibly damaging Het
Ext1 T C 15: 52,969,493 (GRCm39) E365G possibly damaging Het
Fbn1 C A 2: 125,188,370 (GRCm39) V1490F probably damaging Het
Fsip2 A G 2: 82,820,430 (GRCm39) T5388A possibly damaging Het
Gm5431 T A 11: 48,779,536 (GRCm39) N740I probably benign Het
Ifi209 T C 1: 173,472,269 (GRCm39) M370T probably damaging Het
Ighv2-4 G T 12: 113,617,082 (GRCm39) P60Q probably damaging Het
Kif19b A T 5: 140,442,698 (GRCm39) T80S possibly damaging Het
Ldb3 A T 14: 34,299,291 (GRCm39) L111Q probably benign Het
Mcmbp G T 7: 128,308,783 (GRCm39) L413I possibly damaging Het
Mib1 T A 18: 10,795,802 (GRCm39) M721K probably benign Het
Nos3 A G 5: 24,584,809 (GRCm39) T738A probably benign Het
Notch3 T A 17: 32,377,597 (GRCm39) I160L probably benign Het
Nrxn3 C A 12: 89,221,770 (GRCm39) N516K possibly damaging Het
Nt5c2 A G 19: 46,878,250 (GRCm39) Y496H probably benign Het
Or1n1 A T 2: 36,750,177 (GRCm39) L61* probably null Het
Or5b111 T C 19: 13,290,878 (GRCm39) Y257C probably damaging Het
Polm A T 11: 5,779,491 (GRCm39) W436R probably damaging Het
Prex2 T A 1: 11,256,951 (GRCm39) I1221N probably benign Het
Rfpl4b T C 10: 38,696,941 (GRCm39) H220R possibly damaging Het
Rgs12 T C 5: 35,177,676 (GRCm39) F79L probably damaging Het
Rxfp2 A G 5: 149,966,595 (GRCm39) D111G probably benign Het
Smg7 A G 1: 152,715,887 (GRCm39) probably null Het
Spata22 T C 11: 73,224,180 (GRCm39) S34P probably damaging Het
St7 T A 6: 17,855,317 (GRCm39) probably null Het
Stk31 A G 6: 49,400,372 (GRCm39) E399G probably damaging Het
Tcp10b C A 17: 13,292,466 (GRCm39) N296K probably damaging Het
Tonsl T C 15: 76,517,866 (GRCm39) Y645C probably damaging Het
Ttn A T 2: 76,800,206 (GRCm39) M334K probably benign Het
Vcpkmt C A 12: 69,629,619 (GRCm39) V48F probably damaging Het
Vmn2r112 T A 17: 22,822,532 (GRCm39) Y403* probably null Het
Vwa7 G A 17: 35,236,286 (GRCm39) probably null Het
Wscd2 A T 5: 113,726,206 (GRCm39) *572C probably null Het
Xpo7 A G 14: 70,919,787 (GRCm39) L676P probably damaging Het
Zbtb32 A C 7: 30,291,244 (GRCm39) L17W probably damaging Het
Other mutations in Or13f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Or13f5 APN 4 52,825,727 (GRCm39) missense probably damaging 1.00
IGL01758:Or13f5 APN 4 52,825,468 (GRCm39) nonsense probably null
IGL01925:Or13f5 APN 4 52,825,910 (GRCm39) missense probably benign 0.00
IGL02525:Or13f5 APN 4 52,825,616 (GRCm39) missense probably damaging 1.00
IGL02536:Or13f5 APN 4 52,825,817 (GRCm39) missense possibly damaging 0.95
IGL02829:Or13f5 APN 4 52,826,027 (GRCm39) missense probably damaging 0.98
R0068:Or13f5 UTSW 4 52,825,503 (GRCm39) nonsense probably null
R0068:Or13f5 UTSW 4 52,825,503 (GRCm39) nonsense probably null
R0190:Or13f5 UTSW 4 52,825,613 (GRCm39) missense probably damaging 0.97
R4376:Or13f5 UTSW 4 52,826,195 (GRCm39) missense possibly damaging 0.81
R4617:Or13f5 UTSW 4 52,825,399 (GRCm39) start codon destroyed probably benign 0.35
R4658:Or13f5 UTSW 4 52,826,240 (GRCm39) missense probably damaging 0.99
R4828:Or13f5 UTSW 4 52,826,138 (GRCm39) missense probably damaging 1.00
R4850:Or13f5 UTSW 4 52,825,450 (GRCm39) missense possibly damaging 0.94
R6194:Or13f5 UTSW 4 52,825,779 (GRCm39) nonsense probably null
R6842:Or13f5 UTSW 4 52,825,576 (GRCm39) missense probably damaging 1.00
R7033:Or13f5 UTSW 4 52,826,089 (GRCm39) missense probably benign
R7998:Or13f5 UTSW 4 52,825,970 (GRCm39) missense possibly damaging 0.89
R8101:Or13f5 UTSW 4 52,825,849 (GRCm39) missense probably benign 0.03
R9655:Or13f5 UTSW 4 52,825,526 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGAGGATCAGCTCAATGGATG -3'
(R):5'- AGACAGTGAGATCATTTAGTAGGTC -3'

Sequencing Primer
(F):5'- TGGCCGAAGCAAAGCCTTTTC -3'
(R):5'- AAATTAGTGTTTTCTGGGAAATTGGC -3'
Posted On 2018-05-04