Incidental Mutation 'R6401:Rxfp2'
ID516161
Institutional Source Beutler Lab
Gene Symbol Rxfp2
Ensembl Gene ENSMUSG00000053368
Gene Namerelaxin/insulin-like family peptide receptor 2
SynonymsGpr106, Great, LGR8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6401 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location150018675-150082184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150043130 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 111 (D111G)
Ref Sequence ENSEMBL: ENSMUSP00000144536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065745] [ENSMUST00000110496] [ENSMUST00000201612]
Predicted Effect probably benign
Transcript: ENSMUST00000065745
AA Change: D111G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067897
Gene: ENSMUSG00000053368
AA Change: D111G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 8.98e1 SMART
LRR_TYP 287 310 2.24e-3 SMART
LRR 311 334 1.15e1 SMART
LRR 335 358 2.14e1 SMART
Pfam:7tm_1 415 674 1.4e-26 PFAM
low complexity region 682 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110496
AA Change: D111G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106122
Gene: ENSMUSG00000053368
AA Change: D111G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 2.82e0 SMART
LRR 287 310 1.15e1 SMART
LRR 311 334 2.14e1 SMART
Pfam:7tm_1 391 650 1.5e-27 PFAM
low complexity region 658 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143989
Predicted Effect probably benign
Transcript: ENSMUST00000201612
AA Change: D111G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144536
Gene: ENSMUSG00000053368
AA Change: D111G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 1.3e-13 SMART
LRRNT 93 124 1.9e-2 SMART
LRR 120 142 7.4e-1 SMART
LRR 143 166 2.9e-2 SMART
LRR_TYP 167 190 1.2e-7 SMART
LRR 229 252 5.4e-2 SMART
LRR 253 276 1.1e-1 SMART
LRR 277 300 1.2e-2 SMART
LRR 301 324 5e-2 SMART
LRR 325 348 9.3e-2 SMART
Pfam:7tm_1 405 664 1.5e-24 PFAM
low complexity region 672 685 N/A INTRINSIC
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GPCR (G protein-coupled, 7-transmembrane receptor) family. Mutations in this gene are associated with cryptorchidism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit bilateral intraabdominal cryptorchidism and sterility associated with a failure in the differentiation of the gubernaculae, ligaments that control testicular movement during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano3 T A 2: 110,775,114 N249I probably benign Het
Ap3s1 A C 18: 46,758,007 I56L probably benign Het
Cngb1 A G 8: 95,303,739 probably benign Het
Col2a1 T C 15: 97,985,892 T570A unknown Het
Cyp3a16 T C 5: 145,440,364 E471G probably damaging Het
D930020B18Rik A G 10: 121,641,857 N14D possibly damaging Het
Ext1 T C 15: 53,106,097 E365G possibly damaging Het
Fbn1 C A 2: 125,346,450 V1490F probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4869 A T 5: 140,456,943 T80S possibly damaging Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Ifi209 T C 1: 173,644,703 M370T probably damaging Het
Ighv2-4 G T 12: 113,653,462 P60Q probably damaging Het
Ldb3 A T 14: 34,577,334 L111Q probably benign Het
Mcmbp G T 7: 128,707,059 L413I possibly damaging Het
Mib1 T A 18: 10,795,802 M721K probably benign Het
Nos3 A G 5: 24,379,811 T738A probably benign Het
Notch3 T A 17: 32,158,623 I160L probably benign Het
Nrxn3 C A 12: 89,255,000 N516K possibly damaging Het
Nt5c2 A G 19: 46,889,811 Y496H probably benign Het
Olfr1465 T C 19: 13,313,514 Y257C probably damaging Het
Olfr275 A C 4: 52,826,242 T282P probably damaging Het
Olfr351 A T 2: 36,860,165 L61* probably null Het
Polm A T 11: 5,829,491 W436R probably damaging Het
Prex2 T A 1: 11,186,727 I1221N probably benign Het
Rfpl4b T C 10: 38,820,945 H220R possibly damaging Het
Rgs12 T C 5: 35,020,332 F79L probably damaging Het
Smg7 A G 1: 152,840,136 probably null Het
Spata22 T C 11: 73,333,354 S34P probably damaging Het
St7 T A 6: 17,855,318 probably null Het
Stk31 A G 6: 49,423,438 E399G probably damaging Het
Tcp10b C A 17: 13,073,579 N296K probably damaging Het
Tonsl T C 15: 76,633,666 Y645C probably damaging Het
Ttn A T 2: 76,969,862 M334K probably benign Het
Vcpkmt C A 12: 69,582,845 V48F probably damaging Het
Vmn2r112 T A 17: 22,603,551 Y403* probably null Het
Vwa7 G A 17: 35,017,310 probably null Het
Wisp2 T C 2: 163,829,026 I151T probably benign Het
Wscd2 A T 5: 113,588,145 *572C probably null Het
Xpo7 A G 14: 70,682,347 L676P probably damaging Het
Zbtb32 A C 7: 30,591,819 L17W probably damaging Het
Other mutations in Rxfp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rxfp2 APN 5 150066428 missense probably benign
IGL00984:Rxfp2 APN 5 150067132 missense probably benign 0.24
IGL02475:Rxfp2 APN 5 150063686 missense probably benign 0.07
IGL02637:Rxfp2 APN 5 150055913 missense probably damaging 0.99
IGL02992:Rxfp2 APN 5 150051556 missense probably benign 0.01
IGL03052:Rxfp2 APN 5 150043180 splice site probably benign
IGL03203:Rxfp2 APN 5 150063680 missense probably benign 0.08
R0158:Rxfp2 UTSW 5 150051628 missense probably benign 0.14
R0394:Rxfp2 UTSW 5 150067388 missense probably benign 0.03
R0499:Rxfp2 UTSW 5 150066415 missense probably damaging 1.00
R0576:Rxfp2 UTSW 5 150038247 missense probably benign 0.01
R0720:Rxfp2 UTSW 5 150044119 missense probably benign 0.04
R1172:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1173:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1174:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1175:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1606:Rxfp2 UTSW 5 150059897 missense probably benign
R1720:Rxfp2 UTSW 5 150043099 nonsense probably null
R2040:Rxfp2 UTSW 5 150070212 missense probably benign
R3029:Rxfp2 UTSW 5 150043130 missense probably benign 0.05
R3905:Rxfp2 UTSW 5 150055985 splice site probably null
R4056:Rxfp2 UTSW 5 150051633 critical splice donor site probably null
R4156:Rxfp2 UTSW 5 150051555 missense probably benign 0.01
R4282:Rxfp2 UTSW 5 150070270 missense possibly damaging 0.94
R4418:Rxfp2 UTSW 5 150048800 missense probably benign
R4935:Rxfp2 UTSW 5 150051632 critical splice donor site probably null
R5010:Rxfp2 UTSW 5 150067360 missense probably damaging 1.00
R5286:Rxfp2 UTSW 5 150035444 missense probably damaging 1.00
R5373:Rxfp2 UTSW 5 150070260 missense probably benign 0.21
R5374:Rxfp2 UTSW 5 150070260 missense probably benign 0.21
R5530:Rxfp2 UTSW 5 150056810 missense probably damaging 1.00
R5844:Rxfp2 UTSW 5 150043124 missense probably benign 0.00
R6021:Rxfp2 UTSW 5 150063737 missense possibly damaging 0.46
R6211:Rxfp2 UTSW 5 150044126 splice site probably null
R6841:Rxfp2 UTSW 5 150018745 start gained probably benign
R6981:Rxfp2 UTSW 5 150048848 splice site probably null
R7012:Rxfp2 UTSW 5 150081194 missense probably benign 0.00
R7032:Rxfp2 UTSW 5 150070348 missense probably damaging 1.00
R7151:Rxfp2 UTSW 5 150043107 missense probably benign 0.01
R7205:Rxfp2 UTSW 5 150059899 missense probably benign 0.05
R7205:Rxfp2 UTSW 5 150059903 missense probably benign 0.00
R7209:Rxfp2 UTSW 5 150053098 intron probably null
R7468:Rxfp2 UTSW 5 150067336 missense possibly damaging 0.70
R7475:Rxfp2 UTSW 5 150049581 missense possibly damaging 0.94
X0067:Rxfp2 UTSW 5 150051618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGAAGGGCTCAGTGGATC -3'
(R):5'- GCCTGGTTTTAGAAGAAGCTCC -3'

Sequencing Primer
(F):5'- GCTGTCATAAATAAGTACACC -3'
(R):5'- TGGTGCACATACATCCATGTAGG -3'
Posted On2018-05-04