Incidental Mutation 'R6401:Polm'
ID516168
Institutional Source Beutler Lab
Gene Symbol Polm
Ensembl Gene ENSMUSG00000020474
Gene Namepolymerase (DNA directed), mu
SynonymsTdt-N, B230309I03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6401 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location5827860-5838016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5829491 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 436 (W436R)
Ref Sequence ENSEMBL: ENSMUSP00000105463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020767] [ENSMUST00000109837]
Predicted Effect probably damaging
Transcript: ENSMUST00000020767
AA Change: W436R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020767
Gene: ENSMUSG00000020474
AA Change: W436R

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
PDB:2HTF|A 27 124 2e-42 PDB
POLXc 150 495 1.78e-115 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109837
AA Change: W436R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105463
Gene: ENSMUSG00000020474
AA Change: W436R

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Blast:BRCT 27 112 1e-45 BLAST
PDB:2HTF|A 27 124 4e-42 PDB
POLXc 150 500 8.68e-78 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143478
Meta Mutation Damage Score 0.536 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 93% (41/44)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an apparently normal phenotype. However, B cell maturation and proliferation is abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano3 T A 2: 110,775,114 N249I probably benign Het
Ap3s1 A C 18: 46,758,007 I56L probably benign Het
Cngb1 A G 8: 95,303,739 probably benign Het
Col2a1 T C 15: 97,985,892 T570A unknown Het
Cyp3a16 T C 5: 145,440,364 E471G probably damaging Het
D930020B18Rik A G 10: 121,641,857 N14D possibly damaging Het
Ext1 T C 15: 53,106,097 E365G possibly damaging Het
Fbn1 C A 2: 125,346,450 V1490F probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4869 A T 5: 140,456,943 T80S possibly damaging Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Ifi209 T C 1: 173,644,703 M370T probably damaging Het
Ighv2-4 G T 12: 113,653,462 P60Q probably damaging Het
Ldb3 A T 14: 34,577,334 L111Q probably benign Het
Mcmbp G T 7: 128,707,059 L413I possibly damaging Het
Mib1 T A 18: 10,795,802 M721K probably benign Het
Nos3 A G 5: 24,379,811 T738A probably benign Het
Notch3 T A 17: 32,158,623 I160L probably benign Het
Nrxn3 C A 12: 89,255,000 N516K possibly damaging Het
Nt5c2 A G 19: 46,889,811 Y496H probably benign Het
Olfr1465 T C 19: 13,313,514 Y257C probably damaging Het
Olfr275 A C 4: 52,826,242 T282P probably damaging Het
Olfr351 A T 2: 36,860,165 L61* probably null Het
Prex2 T A 1: 11,186,727 I1221N probably benign Het
Rfpl4b T C 10: 38,820,945 H220R possibly damaging Het
Rgs12 T C 5: 35,020,332 F79L probably damaging Het
Rxfp2 A G 5: 150,043,130 D111G probably benign Het
Smg7 A G 1: 152,840,136 probably null Het
Spata22 T C 11: 73,333,354 S34P probably damaging Het
St7 T A 6: 17,855,318 probably null Het
Stk31 A G 6: 49,423,438 E399G probably damaging Het
Tcp10b C A 17: 13,073,579 N296K probably damaging Het
Tonsl T C 15: 76,633,666 Y645C probably damaging Het
Ttn A T 2: 76,969,862 M334K probably benign Het
Vcpkmt C A 12: 69,582,845 V48F probably damaging Het
Vmn2r112 T A 17: 22,603,551 Y403* probably null Het
Vwa7 G A 17: 35,017,310 probably null Het
Wisp2 T C 2: 163,829,026 I151T probably benign Het
Wscd2 A T 5: 113,588,145 *572C probably null Het
Xpo7 A G 14: 70,682,347 L676P probably damaging Het
Zbtb32 A C 7: 30,591,819 L17W probably damaging Het
Other mutations in Polm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02184:Polm APN 11 5830137 missense probably benign 0.00
gott UTSW 11 5829512 missense possibly damaging 0.46
lobet UTSW 11 5829491 missense probably damaging 1.00
IGL02988:Polm UTSW 11 5836343 missense probably benign 0.02
R0626:Polm UTSW 11 5836207 missense probably damaging 0.97
R0736:Polm UTSW 11 5835495 missense possibly damaging 0.94
R1723:Polm UTSW 11 5834776 missense probably benign 0.04
R1893:Polm UTSW 11 5835574 missense possibly damaging 0.65
R2473:Polm UTSW 11 5829881 missense possibly damaging 0.94
R3812:Polm UTSW 11 5829512 missense possibly damaging 0.46
R4676:Polm UTSW 11 5835749 nonsense probably null
R4705:Polm UTSW 11 5837663 missense possibly damaging 0.66
R4988:Polm UTSW 11 5837618 missense probably damaging 0.98
R5276:Polm UTSW 11 5829393 missense probably benign 0.16
R6783:Polm UTSW 11 5835534 missense probably damaging 1.00
X0018:Polm UTSW 11 5830158 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGATCAAACAGCCCATGG -3'
(R):5'- CTGTATCACCAGTACCACCG -3'

Sequencing Primer
(F):5'- GCTTCCTTTAGCAGGGTT -3'
(R):5'- GTACCACCGCAGCCATTTG -3'
Posted On2018-05-04