Incidental Mutation 'R6401:Tcp10b'
ID516179
Institutional Source Beutler Lab
Gene Symbol Tcp10b
Ensembl Gene ENSMUSG00000055602
Gene Namet-complex protein 10b
SynonymsT66B-a, Tcp-10bt, Tcp-10b, D17Leh66ba, D17Leh66B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6401 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location13061104-13082481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 13073579 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 296 (N296K)
Ref Sequence ENSEMBL: ENSMUSP00000128059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086787] [ENSMUST00000116666] [ENSMUST00000163227]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086787
AA Change: N296K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083997
Gene: ENSMUSG00000055602
AA Change: N296K

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 245 255 N/A INTRINSIC
Pfam:Tcp10_C 261 438 2.3e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116666
AA Change: N296K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112365
Gene: ENSMUSG00000055602
AA Change: N296K

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 245 255 N/A INTRINSIC
Pfam:Tcp10_C 263 437 1.5e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163227
AA Change: N296K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128059
Gene: ENSMUSG00000055602
AA Change: N296K

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 245 255 N/A INTRINSIC
Pfam:Tcp10_C 261 401 1.3e-68 PFAM
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 93% (41/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano3 T A 2: 110,775,114 N249I probably benign Het
Ap3s1 A C 18: 46,758,007 I56L probably benign Het
Cngb1 A G 8: 95,303,739 probably benign Het
Col2a1 T C 15: 97,985,892 T570A unknown Het
Cyp3a16 T C 5: 145,440,364 E471G probably damaging Het
D930020B18Rik A G 10: 121,641,857 N14D possibly damaging Het
Ext1 T C 15: 53,106,097 E365G possibly damaging Het
Fbn1 C A 2: 125,346,450 V1490F probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4869 A T 5: 140,456,943 T80S possibly damaging Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Ifi209 T C 1: 173,644,703 M370T probably damaging Het
Ighv2-4 G T 12: 113,653,462 P60Q probably damaging Het
Ldb3 A T 14: 34,577,334 L111Q probably benign Het
Mcmbp G T 7: 128,707,059 L413I possibly damaging Het
Mib1 T A 18: 10,795,802 M721K probably benign Het
Nos3 A G 5: 24,379,811 T738A probably benign Het
Notch3 T A 17: 32,158,623 I160L probably benign Het
Nrxn3 C A 12: 89,255,000 N516K possibly damaging Het
Nt5c2 A G 19: 46,889,811 Y496H probably benign Het
Olfr1465 T C 19: 13,313,514 Y257C probably damaging Het
Olfr275 A C 4: 52,826,242 T282P probably damaging Het
Olfr351 A T 2: 36,860,165 L61* probably null Het
Polm A T 11: 5,829,491 W436R probably damaging Het
Prex2 T A 1: 11,186,727 I1221N probably benign Het
Rfpl4b T C 10: 38,820,945 H220R possibly damaging Het
Rgs12 T C 5: 35,020,332 F79L probably damaging Het
Rxfp2 A G 5: 150,043,130 D111G probably benign Het
Smg7 A G 1: 152,840,136 probably null Het
Spata22 T C 11: 73,333,354 S34P probably damaging Het
St7 T A 6: 17,855,318 probably null Het
Stk31 A G 6: 49,423,438 E399G probably damaging Het
Tonsl T C 15: 76,633,666 Y645C probably damaging Het
Ttn A T 2: 76,969,862 M334K probably benign Het
Vcpkmt C A 12: 69,582,845 V48F probably damaging Het
Vmn2r112 T A 17: 22,603,551 Y403* probably null Het
Vwa7 G A 17: 35,017,310 probably null Het
Wisp2 T C 2: 163,829,026 I151T probably benign Het
Wscd2 A T 5: 113,588,145 *572C probably null Het
Xpo7 A G 14: 70,682,347 L676P probably damaging Het
Zbtb32 A C 7: 30,591,819 L17W probably damaging Het
Other mutations in Tcp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Tcp10b APN 17 13080160 missense probably damaging 1.00
IGL03296:Tcp10b APN 17 13073556 missense probably damaging 0.97
H8441:Tcp10b UTSW 17 13070861 missense probably damaging 0.98
R1817:Tcp10b UTSW 17 13067703 missense possibly damaging 0.92
R1901:Tcp10b UTSW 17 13081626 missense possibly damaging 0.56
R4657:Tcp10b UTSW 17 13073617 critical splice donor site probably null
R4749:Tcp10b UTSW 17 13070945 critical splice donor site probably null
R5335:Tcp10b UTSW 17 13063067 critical splice donor site probably null
R7161:Tcp10b UTSW 17 13081746 makesense probably null
X0062:Tcp10b UTSW 17 13063061 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCAGTTAGTATCCAGCATGTC -3'
(R):5'- AAGAAAGTGCTGACCTCATGC -3'

Sequencing Primer
(F):5'- ACAGTGGGCAGTGATTTTGAATAC -3'
(R):5'- AAGTGCTGACCTCATGCCTTCC -3'
Posted On2018-05-04