Incidental Mutation 'R6401:Nt5c2'
ID516186
Institutional Source Beutler Lab
Gene Symbol Nt5c2
Ensembl Gene ENSMUSG00000025041
Gene Name5'-nucleotidase, cytosolic II
SynonymsPNT5, NT5B, cN-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R6401 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46886831-47015153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46889811 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 496 (Y496H)
Ref Sequence ENSEMBL: ENSMUSP00000130898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086961] [ENSMUST00000168536] [ENSMUST00000172239]
Predicted Effect probably benign
Transcript: ENSMUST00000086961
AA Change: Y495H

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000084180
Gene: ENSMUSG00000025041
AA Change: Y495H

DomainStartEndE-ValueType
Pfam:5_nucleotid 60 518 3.5e-185 PFAM
low complexity region 574 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168536
AA Change: Y470H

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129126
Gene: ENSMUSG00000025041
AA Change: Y470H

DomainStartEndE-ValueType
Pfam:5_nucleotid 35 493 1.6e-185 PFAM
low complexity region 549 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172239
AA Change: Y496H

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000130898
Gene: ENSMUSG00000025041
AA Change: Y496H

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
Pfam:5_nucleotid 61 515 6.5e-179 PFAM
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174731
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that serves as an important role in cellular purine metabolism by acting primarily on inosine 5'-monophosphate and other purine nucleotides. [provided by RefSeq, Oct 2011]
PHENOTYPE: Bone marrow cells with a nucleotide substitution allele used in a transplantation experiment following tamoxifen-induction produce NOTCH1-induced tumors that are resistant to 6-mercaptopurine chemotherapy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano3 T A 2: 110,775,114 N249I probably benign Het
Ap3s1 A C 18: 46,758,007 I56L probably benign Het
Cngb1 A G 8: 95,303,739 probably benign Het
Col2a1 T C 15: 97,985,892 T570A unknown Het
Cyp3a16 T C 5: 145,440,364 E471G probably damaging Het
D930020B18Rik A G 10: 121,641,857 N14D possibly damaging Het
Ext1 T C 15: 53,106,097 E365G possibly damaging Het
Fbn1 C A 2: 125,346,450 V1490F probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4869 A T 5: 140,456,943 T80S possibly damaging Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Ifi209 T C 1: 173,644,703 M370T probably damaging Het
Ighv2-4 G T 12: 113,653,462 P60Q probably damaging Het
Ldb3 A T 14: 34,577,334 L111Q probably benign Het
Mcmbp G T 7: 128,707,059 L413I possibly damaging Het
Mib1 T A 18: 10,795,802 M721K probably benign Het
Nos3 A G 5: 24,379,811 T738A probably benign Het
Notch3 T A 17: 32,158,623 I160L probably benign Het
Nrxn3 C A 12: 89,255,000 N516K possibly damaging Het
Olfr1465 T C 19: 13,313,514 Y257C probably damaging Het
Olfr275 A C 4: 52,826,242 T282P probably damaging Het
Olfr351 A T 2: 36,860,165 L61* probably null Het
Polm A T 11: 5,829,491 W436R probably damaging Het
Prex2 T A 1: 11,186,727 I1221N probably benign Het
Rfpl4b T C 10: 38,820,945 H220R possibly damaging Het
Rgs12 T C 5: 35,020,332 F79L probably damaging Het
Rxfp2 A G 5: 150,043,130 D111G probably benign Het
Smg7 A G 1: 152,840,136 probably null Het
Spata22 T C 11: 73,333,354 S34P probably damaging Het
St7 T A 6: 17,855,318 probably null Het
Stk31 A G 6: 49,423,438 E399G probably damaging Het
Tcp10b C A 17: 13,073,579 N296K probably damaging Het
Tonsl T C 15: 76,633,666 Y645C probably damaging Het
Ttn A T 2: 76,969,862 M334K probably benign Het
Vcpkmt C A 12: 69,582,845 V48F probably damaging Het
Vmn2r112 T A 17: 22,603,551 Y403* probably null Het
Vwa7 G A 17: 35,017,310 probably null Het
Wisp2 T C 2: 163,829,026 I151T probably benign Het
Wscd2 A T 5: 113,588,145 *572C probably null Het
Xpo7 A G 14: 70,682,347 L676P probably damaging Het
Zbtb32 A C 7: 30,591,819 L17W probably damaging Het
Other mutations in Nt5c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nt5c2 APN 19 46896515 missense possibly damaging 0.91
IGL00814:Nt5c2 APN 19 46897648 missense probably benign 0.02
IGL02347:Nt5c2 APN 19 46924256 splice site probably benign
IGL02630:Nt5c2 APN 19 46924310 missense probably benign 0.00
tightrope UTSW 19 46924327 missense probably damaging 1.00
R0565:Nt5c2 UTSW 19 46897625 missense probably damaging 0.99
R0825:Nt5c2 UTSW 19 46898905 unclassified probably benign
R0980:Nt5c2 UTSW 19 46898878 missense probably benign
R1496:Nt5c2 UTSW 19 46904978 missense probably damaging 1.00
R2394:Nt5c2 UTSW 19 46890067 critical splice donor site probably null
R3854:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R3855:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R3856:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R4534:Nt5c2 UTSW 19 46891661 missense probably damaging 1.00
R4907:Nt5c2 UTSW 19 46896539 missense possibly damaging 0.71
R5122:Nt5c2 UTSW 19 46889921 missense probably damaging 1.00
R5203:Nt5c2 UTSW 19 46889808 missense probably damaging 1.00
R5226:Nt5c2 UTSW 19 46898629 missense probably damaging 1.00
R5254:Nt5c2 UTSW 19 46893560 nonsense probably null
R5315:Nt5c2 UTSW 19 46892243 missense probably damaging 1.00
R6784:Nt5c2 UTSW 19 46924327 missense probably damaging 1.00
R7040:Nt5c2 UTSW 19 46893535 missense possibly damaging 0.52
R7414:Nt5c2 UTSW 19 46889889 missense probably damaging 1.00
X0028:Nt5c2 UTSW 19 46891615 missense probably damaging 1.00
X0065:Nt5c2 UTSW 19 46890088 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGCACCTCTCAATGTAACCC -3'
(R):5'- CTTGTATGTAGTTGCATAGCTGAGACC -3'

Sequencing Primer
(F):5'- CAGATGGCTGTGAGCTACCATG -3'
(R):5'- ATGATGGGAAGCCTGTTC -3'
Posted On2018-05-04