Incidental Mutation 'R6403:Krt9'
ID516227
Institutional Source Beutler Lab
Gene Symbol Krt9
Ensembl Gene ENSMUSG00000051617
Gene Namekeratin 9
SynonymsKrt1-9, K9
MMRRC Submission 044382-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6403 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100186781-100193246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100189659 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 420 (S420R)
Ref Sequence ENSEMBL: ENSMUSP00000055255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059707]
Predicted Effect probably damaging
Transcript: ENSMUST00000059707
AA Change: S420R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055255
Gene: ENSMUSG00000051617
AA Change: S420R

DomainStartEndE-ValueType
low complexity region 6 125 N/A INTRINSIC
Filament 130 442 2.96e-124 SMART
low complexity region 462 716 N/A INTRINSIC
low complexity region 721 737 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperpigmented calluses on the footpad with acanthosis, hyperkeratosis, thick epidermis and increased keratinocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,249 D227G possibly damaging Het
Aox1 A G 1: 58,068,435 I623V probably damaging Het
Camsap2 G A 1: 136,280,800 R317* probably null Het
Carmil1 G A 13: 24,081,967 R271C probably damaging Het
Ces2b T A 8: 104,836,269 L323* probably null Het
Copb1 T A 7: 114,238,451 I286F probably damaging Het
Dnajb11 T A 16: 22,870,941 V285D probably damaging Het
Dok5 G T 2: 170,829,900 A79S probably damaging Het
Enpp2 T C 15: 54,863,764 N557S probably damaging Het
Gm13088 G A 4: 143,655,773 Q118* probably null Het
Hexa G A 9: 59,557,361 R178H probably damaging Het
Iars T C 13: 49,687,495 S35P probably damaging Het
Il3ra G T 14: 14,347,137 A3S probably damaging Het
Iqcm T C 8: 75,577,996 probably null Het
Lca5l T C 16: 96,173,845 N293S probably benign Het
Mb21d2 A G 16: 28,828,517 I235T possibly damaging Het
Ncbp3 A G 11: 73,078,976 T550A probably benign Het
Nckipsd G T 9: 108,811,683 R139L possibly damaging Het
Nxn A G 11: 76,399,020 V14A probably benign Het
Olfr926 T C 9: 38,877,242 L22P probably damaging Het
Rprd2 C A 3: 95,766,087 C668F possibly damaging Het
Tmem87a A T 2: 120,380,771 M231K possibly damaging Het
Trappc8 A G 18: 20,866,071 V333A probably benign Het
Trit1 C A 4: 123,039,579 T103K possibly damaging Het
Tspan13 A G 12: 36,015,705 F203S probably damaging Het
Vmn2r114 C T 17: 23,309,965 D388N probably damaging Het
Zfp617 C T 8: 71,929,171 A55V probably benign Het
Other mutations in Krt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Krt9 APN 11 100190006 missense probably damaging 1.00
IGL01695:Krt9 APN 11 100191437 critical splice donor site probably null
IGL02383:Krt9 APN 11 100191215 missense probably damaging 1.00
IGL02529:Krt9 APN 11 100189966 missense probably damaging 0.99
IGL02819:Krt9 APN 11 100191520 missense probably damaging 1.00
R1356:Krt9 UTSW 11 100188814 small insertion probably benign
R1397:Krt9 UTSW 11 100192638 missense probably damaging 1.00
R1498:Krt9 UTSW 11 100188369 nonsense probably null
R1772:Krt9 UTSW 11 100191305 missense probably damaging 0.99
R1871:Krt9 UTSW 11 100190788 missense probably damaging 1.00
R1883:Krt9 UTSW 11 100188697 missense unknown
R1985:Krt9 UTSW 11 100189991 missense probably benign 0.02
R2056:Krt9 UTSW 11 100191495 missense probably damaging 1.00
R2253:Krt9 UTSW 11 100190859 missense possibly damaging 0.83
R2305:Krt9 UTSW 11 100193116 missense unknown
R2875:Krt9 UTSW 11 100189205 nonsense probably null
R3813:Krt9 UTSW 11 100189677 missense probably damaging 1.00
R3874:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4157:Krt9 UTSW 11 100188649 missense unknown
R4762:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4873:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4875:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4923:Krt9 UTSW 11 100189077 small deletion probably benign
R4973:Krt9 UTSW 11 100188712 missense unknown
R5153:Krt9 UTSW 11 100191242 missense probably damaging 0.99
R5658:Krt9 UTSW 11 100190767 missense probably damaging 0.98
R5696:Krt9 UTSW 11 100189077 small deletion probably benign
R5944:Krt9 UTSW 11 100188439 missense unknown
R6147:Krt9 UTSW 11 100188839 missense unknown
R6476:Krt9 UTSW 11 100190814 missense probably damaging 1.00
R6822:Krt9 UTSW 11 100189077 small deletion probably benign
R7159:Krt9 UTSW 11 100189077 small deletion probably benign
R7174:Krt9 UTSW 11 100189077 small deletion probably benign
R7203:Krt9 UTSW 11 100190791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGAAATCCTCAGTCCATCAG -3'
(R):5'- TGGAACATCCCTTCTGAAGTTTC -3'

Sequencing Primer
(F):5'- AGACCCTTGCATACTTTTCTAGATG -3'
(R):5'- CCTTTCGCTTCCTAGAAATCAGC -3'
Posted On2018-05-04