Incidental Mutation 'R6405:Slc7a9'
ID516255
Institutional Source Beutler Lab
Gene Symbol Slc7a9
Ensembl Gene ENSMUSG00000030492
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 9
Synonymsb, + amino acid transporter, CSNU3, b, +AT
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R6405 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location35448796-35466036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35454639 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 229 (L229P)
Ref Sequence ENSEMBL: ENSMUSP00000112726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032703] [ENSMUST00000118383] [ENSMUST00000118969] [ENSMUST00000141245]
Predicted Effect probably damaging
Transcript: ENSMUST00000032703
AA Change: L229P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032703
Gene: ENSMUSG00000030492
AA Change: L229P

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 456 9e-67 PFAM
Pfam:AA_permease 35 468 4.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118383
AA Change: L229P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113181
Gene: ENSMUSG00000030492
AA Change: L229P

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 456 9e-67 PFAM
Pfam:AA_permease 35 468 4.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118969
AA Change: L229P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112726
Gene: ENSMUSG00000030492
AA Change: L229P

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 457 1.8e-65 PFAM
Pfam:AA_permease 35 468 2.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147026
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of light subunits of amino acid transporters. This protein plays a role in the high-affinity and sodium-independent transport of cystine and neutral and dibasic amino acids, and appears to function in the reabsorption of cystine in the kidney tubule. Mutations in this gene cause non-type I cystinuria, a disease that leads to cystine stones in the urinary system due to impaired transport of cystine and dibasic amino acids. Alternate transcript variants, which encode the same protein, have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Inactivation of this locus leads to renal absorption defects and cystine urolithiasis, similar to the symptoms observed in patients with cystinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,851,878 V769A probably damaging Het
Abca4 A G 3: 122,173,662 probably null Het
Ahnak2 A T 12: 112,773,337 S628T probably damaging Het
Ano8 T C 8: 71,483,030 T315A probably damaging Het
Arhgap32 T A 9: 32,248,488 V267E probably benign Het
Asnsd1 A T 1: 53,347,995 S158T probably damaging Het
Asxl2 T A 12: 3,493,758 V309E probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc110 T A 8: 45,941,697 Y208* probably null Het
Cfap157 G T 2: 32,781,396 Q133K probably damaging Het
Cfap53 A G 18: 74,359,606 E467G probably damaging Het
Csmd3 T C 15: 47,820,371 I1688M probably damaging Het
Cyp3a11 A T 5: 145,862,420 L319Q probably damaging Het
Dchs2 A G 3: 83,354,263 I2613V probably benign Het
Dhx35 T A 2: 158,794,919 W11R probably damaging Het
Dscam C T 16: 96,678,425 G1174D probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Greb1l T A 18: 10,501,076 I402K probably benign Het
Hectd3 A T 4: 117,000,624 M585L probably benign Het
Inpp5k T C 11: 75,633,178 probably null Het
Lalba T G 15: 98,480,751 probably null Het
Lgals9 C A 11: 78,971,385 V125L probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr117 A G 17: 37,660,123 I70T possibly damaging Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Rab4b T A 7: 27,172,954 D94V probably damaging Het
Rhpn2 A G 7: 35,372,439 E243G probably benign Het
Rp1 T C 1: 4,345,771 D1706G probably damaging Het
Slc29a3 A T 10: 60,716,026 I413N probably damaging Het
Tenm2 T C 11: 36,864,859 H104R probably benign Het
Tmem87a A G 2: 120,379,750 Y241H probably damaging Het
Trpv5 G T 6: 41,674,668 T192K probably damaging Het
Unc79 T C 12: 103,168,336 V2189A probably damaging Het
Vmn2r106 A C 17: 20,279,099 S183R probably benign Het
Vmn2r112 G T 17: 22,618,235 C559F probably damaging Het
Wdhd1 T C 14: 47,243,867 D1031G possibly damaging Het
Wnt5b T C 6: 119,433,496 S328G probably benign Het
Zcchc7 T C 4: 44,926,032 Y344H probably damaging Het
Other mutations in Slc7a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Slc7a9 APN 7 35460887 missense probably damaging 0.97
IGL01538:Slc7a9 APN 7 35454164 missense probably damaging 0.97
IGL01860:Slc7a9 APN 7 35457060 missense probably damaging 1.00
IGL02291:Slc7a9 APN 7 35457014 missense probably damaging 1.00
IGL02436:Slc7a9 APN 7 35457053 missense probably benign 0.23
IGL02525:Slc7a9 APN 7 35453435 missense probably damaging 1.00
IGL03296:Slc7a9 APN 7 35452427 missense probably damaging 1.00
R0006:Slc7a9 UTSW 7 35470100 unclassified probably benign
R1703:Slc7a9 UTSW 7 35454575 missense probably benign
R1886:Slc7a9 UTSW 7 35453402 missense possibly damaging 0.94
R1886:Slc7a9 UTSW 7 35453403 missense probably damaging 0.96
R1907:Slc7a9 UTSW 7 35449854 missense probably benign 0.00
R2027:Slc7a9 UTSW 7 35454137 missense probably damaging 0.97
R2133:Slc7a9 UTSW 7 35453493 missense probably damaging 0.99
R2937:Slc7a9 UTSW 7 35463742 nonsense probably null
R3684:Slc7a9 UTSW 7 35453501 missense probably benign 0.02
R4506:Slc7a9 UTSW 7 35453420 missense probably damaging 1.00
R4731:Slc7a9 UTSW 7 35453563 nonsense probably null
R4732:Slc7a9 UTSW 7 35453563 nonsense probably null
R4733:Slc7a9 UTSW 7 35453563 nonsense probably null
R5007:Slc7a9 UTSW 7 35454129 missense probably benign 0.09
R6175:Slc7a9 UTSW 7 35465852 missense probably damaging 1.00
R6701:Slc7a9 UTSW 7 35459849 missense probably damaging 1.00
R6932:Slc7a9 UTSW 7 35452511 missense probably benign 0.16
X0022:Slc7a9 UTSW 7 35452502 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTCACAAGTCATAGCCTTCTTTCTG -3'
(R):5'- CCAGTTGCAGGCTAGGAAAG -3'

Sequencing Primer
(F):5'- AAGTCATAGCCTTCTTTCTGTTAGG -3'
(R):5'- TTGACCCCATGATGTCACAGG -3'
Posted On2018-05-04