Incidental Mutation 'R6406:Olfr1012'
ID516283
Institutional Source Beutler Lab
Gene Symbol Olfr1012
Ensembl Gene ENSMUSG00000075210
Gene Nameolfactory receptor 1012
SynonymsGA_x6K02T2Q125-47239120-47238185, MOR213-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.045) question?
Stock #R6406 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85757353-85762766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85760307 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 23 (Q23L)
Ref Sequence ENSEMBL: ENSMUSP00000148952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099916] [ENSMUST00000214255] [ENSMUST00000214958]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099916
AA Change: Q23L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097500
Gene: ENSMUSG00000075210
AA Change: Q23L

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 1.7e-47 PFAM
Pfam:7tm_1 40 289 8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214255
AA Change: Q23L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214958
AA Change: Q23L

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,506,939 P29L probably benign Het
Acsm1 A G 7: 119,662,261 N567S probably benign Het
Ahi1 T G 10: 20,977,049 N505K probably damaging Het
Ank2 T A 3: 127,032,225 D356V probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifb6 C A 2: 153,904,537 T117K possibly damaging Het
C2cd6 T C 1: 59,058,676 E418G possibly damaging Het
Cbx1 A T 11: 96,801,538 K84* probably null Het
Cr2 A G 1: 195,169,771 L90P probably damaging Het
Dclk1 A G 3: 55,480,406 D91G probably damaging Het
Dock1 C A 7: 135,145,486 Q1509K probably benign Het
Fzd1 T G 5: 4,756,089 T498P probably damaging Het
Galnt12 A G 4: 47,122,534 N271S probably benign Het
Gm12888 A G 4: 121,319,457 I49T possibly damaging Het
Gria4 A T 9: 4,427,077 W788R probably damaging Het
Ilf3 C T 9: 21,396,244 A379V probably damaging Het
Islr2 A G 9: 58,199,980 V43A probably benign Het
Jag1 T A 2: 137,087,643 N782I probably damaging Het
Klhl8 T A 5: 103,863,115 I539F possibly damaging Het
Lama5 A T 2: 180,197,464 C750* probably null Het
Lrrc37a T A 11: 103,497,535 T2355S unknown Het
Lrrc8a A G 2: 30,257,091 H639R possibly damaging Het
Map1a A T 2: 121,300,743 D442V probably damaging Het
Mier3 T C 13: 111,709,809 probably null Het
Msantd1 C A 5: 34,923,321 probably null Het
Ncapd2 C A 6: 125,173,878 A785S probably benign Het
Ncbp2 CTCGTCTGG C 16: 31,956,341 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Ndst4 T C 3: 125,438,501 S240P probably benign Het
Nek9 T C 12: 85,339,172 D17G probably damaging Het
Nkx6-1 C T 5: 101,663,811 A142T unknown Het
Nt5dc1 T C 10: 34,324,408 H205R probably benign Het
Olfr1442 T C 19: 12,674,820 I205T probably benign Het
Pafah1b1 A G 11: 74,682,272 M322T probably benign Het
Parp2 A G 14: 50,819,477 N353D probably benign Het
Pdcd6ip T C 9: 113,674,344 N452S possibly damaging Het
Pkd1l2 A G 8: 117,035,847 V1397A probably damaging Het
Prkdc T A 16: 15,717,801 L1675Q probably damaging Het
Ptprt T C 2: 161,553,783 I1157V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Sele G T 1: 164,050,743 C217F probably damaging Het
Spats1 T A 17: 45,457,265 H125L probably damaging Het
Stard3 T C 11: 98,378,769 V330A probably benign Het
Synj2 T A 17: 6,019,571 probably benign Het
Thoc1 T A 18: 9,977,963 F301L probably damaging Het
Thumpd3 G A 6: 113,055,963 E221K probably damaging Het
Trim61 T C 8: 65,013,725 T295A possibly damaging Het
Trp53bp1 T C 2: 121,270,612 Q35R probably damaging Het
Tsnaxip1 C T 8: 105,843,983 T578I probably benign Het
Other mutations in Olfr1012
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01799:Olfr1012 APN 2 85759642 missense probably benign 0.30
IGL02334:Olfr1012 APN 2 85760159 nonsense probably null
IGL03050:Olfr1012 UTSW 2 85759441 makesense probably null
R0399:Olfr1012 UTSW 2 85759904 missense possibly damaging 0.53
R1730:Olfr1012 UTSW 2 85760242 missense possibly damaging 0.91
R2142:Olfr1012 UTSW 2 85759677 missense probably benign 0.07
R2185:Olfr1012 UTSW 2 85760019 missense probably damaging 1.00
R2412:Olfr1012 UTSW 2 85759680 missense probably damaging 0.99
R3552:Olfr1012 UTSW 2 85759893 missense possibly damaging 0.46
R3785:Olfr1012 UTSW 2 85759453 missense probably benign 0.00
R4096:Olfr1012 UTSW 2 85759696 missense possibly damaging 0.55
R4097:Olfr1012 UTSW 2 85759696 missense possibly damaging 0.55
R5199:Olfr1012 UTSW 2 85760214 missense probably damaging 1.00
R5206:Olfr1012 UTSW 2 85759623 missense probably benign 0.31
R5444:Olfr1012 UTSW 2 85759919 missense probably benign 0.39
R5567:Olfr1012 UTSW 2 85759650 missense probably damaging 1.00
R5570:Olfr1012 UTSW 2 85759650 missense probably damaging 1.00
R5956:Olfr1012 UTSW 2 85753839 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGACATCCTGCAAAGGAGATGC -3'
(R):5'- ACCCTGGTGCTGATTATGTTACAG -3'

Sequencing Primer
(F):5'- TCTTCAGAGATGCAGGTCACCAG -3'
(R):5'- TGCTGATTATGTTACAGGAGTTTATC -3'
Posted On2018-05-04