Incidental Mutation 'R6406:Bpifb6'
ID516287
Institutional Source Beutler Lab
Gene Symbol Bpifb6
Ensembl Gene ENSMUSG00000068009
Gene NameBPI fold containing family B, member 6
SynonymsLOC228796, Bpil3
MMRRC Submission
Accession Numbers

Genbank: NM_199303; MGI: 2684965

Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6406 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location153900388-153912795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 153904537 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 117 (T117K)
Ref Sequence ENSEMBL: ENSMUSP00000119046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088955] [ENSMUST00000135501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088955
AA Change: T117K

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086347
Gene: ENSMUSG00000068009
AA Change: T117K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
BPI1 22 228 7.83e-3 SMART
BPI2 245 446 2.5e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135501
AA Change: T117K

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119046
Gene: ENSMUSG00000068009
AA Change: T117K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
BPI1 22 228 7.83e-3 SMART
Blast:BPI2 245 279 1e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,506,939 P29L probably benign Het
Acsm1 A G 7: 119,662,261 N567S probably benign Het
Ahi1 T G 10: 20,977,049 N505K probably damaging Het
Ank2 T A 3: 127,032,225 D356V probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C2cd6 T C 1: 59,058,676 E418G possibly damaging Het
Cbx1 A T 11: 96,801,538 K84* probably null Het
Cr2 A G 1: 195,169,771 L90P probably damaging Het
Dclk1 A G 3: 55,480,406 D91G probably damaging Het
Dock1 C A 7: 135,145,486 Q1509K probably benign Het
Fzd1 T G 5: 4,756,089 T498P probably damaging Het
Galnt12 A G 4: 47,122,534 N271S probably benign Het
Gm12888 A G 4: 121,319,457 I49T possibly damaging Het
Gria4 A T 9: 4,427,077 W788R probably damaging Het
Ilf3 C T 9: 21,396,244 A379V probably damaging Het
Islr2 A G 9: 58,199,980 V43A probably benign Het
Jag1 T A 2: 137,087,643 N782I probably damaging Het
Klhl8 T A 5: 103,863,115 I539F possibly damaging Het
Lama5 A T 2: 180,197,464 C750* probably null Het
Lrrc37a T A 11: 103,497,535 T2355S unknown Het
Lrrc8a A G 2: 30,257,091 H639R possibly damaging Het
Map1a A T 2: 121,300,743 D442V probably damaging Het
Mier3 T C 13: 111,709,809 probably null Het
Msantd1 C A 5: 34,923,321 probably null Het
Ncapd2 C A 6: 125,173,878 A785S probably benign Het
Ncbp2 CTCGTCTGG C 16: 31,956,341 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Ndst4 T C 3: 125,438,501 S240P probably benign Het
Nek9 T C 12: 85,339,172 D17G probably damaging Het
Nkx6-1 C T 5: 101,663,811 A142T unknown Het
Nt5dc1 T C 10: 34,324,408 H205R probably benign Het
Olfr1012 T A 2: 85,760,307 Q23L possibly damaging Het
Olfr1442 T C 19: 12,674,820 I205T probably benign Het
Pafah1b1 A G 11: 74,682,272 M322T probably benign Het
Parp2 A G 14: 50,819,477 N353D probably benign Het
Pdcd6ip T C 9: 113,674,344 N452S possibly damaging Het
Pkd1l2 A G 8: 117,035,847 V1397A probably damaging Het
Prkdc T A 16: 15,717,801 L1675Q probably damaging Het
Ptprt T C 2: 161,553,783 I1157V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Sele G T 1: 164,050,743 C217F probably damaging Het
Spats1 T A 17: 45,457,265 H125L probably damaging Het
Stard3 T C 11: 98,378,769 V330A probably benign Het
Synj2 T A 17: 6,019,571 probably benign Het
Thoc1 T A 18: 9,977,963 F301L probably damaging Het
Thumpd3 G A 6: 113,055,963 E221K probably damaging Het
Trim61 T C 8: 65,013,725 T295A possibly damaging Het
Trp53bp1 T C 2: 121,270,612 Q35R probably damaging Het
Tsnaxip1 C T 8: 105,843,983 T578I probably benign Het
Other mutations in Bpifb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02691:Bpifb6 APN 2 153902645 missense unknown
IGL03143:Bpifb6 APN 2 153902735 missense probably damaging 1.00
R0157:Bpifb6 UTSW 2 153903966 missense probably benign 0.04
R1607:Bpifb6 UTSW 2 153906861 missense probably damaging 1.00
R1678:Bpifb6 UTSW 2 153908642 missense probably damaging 0.96
R1745:Bpifb6 UTSW 2 153911483 missense possibly damaging 0.85
R1786:Bpifb6 UTSW 2 153906861 missense probably damaging 1.00
R1990:Bpifb6 UTSW 2 153905350 critical splice donor site probably null
R2087:Bpifb6 UTSW 2 153906078 missense possibly damaging 0.88
R3717:Bpifb6 UTSW 2 153908141 unclassified probably benign
R4449:Bpifb6 UTSW 2 153906768 missense possibly damaging 0.56
R4450:Bpifb6 UTSW 2 153906768 missense possibly damaging 0.56
R4709:Bpifb6 UTSW 2 153908516 missense possibly damaging 0.87
R4710:Bpifb6 UTSW 2 153908516 missense possibly damaging 0.87
R6113:Bpifb6 UTSW 2 153910731 missense probably benign
R6267:Bpifb6 UTSW 2 153906892 missense possibly damaging 0.50
R6296:Bpifb6 UTSW 2 153906892 missense possibly damaging 0.50
R7049:Bpifb6 UTSW 2 153908813 intron probably null
R7098:Bpifb6 UTSW 2 153906890 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGCTTTTCACCATGTGTG -3'
(R):5'- TGCATCAATGGCACCAAATTG -3'

Sequencing Primer
(F):5'- CCATGTGTGGGTAGATCCTGCC -3'
(R):5'- TCAATGGCACCAAATTGGACAG -3'
Posted On2018-05-04