Incidental Mutation 'R6406:Dclk1'
ID516290
Institutional Source Beutler Lab
Gene Symbol Dclk1
Ensembl Gene ENSMUSG00000027797
Gene Namedoublecortin-like kinase 1
Synonyms2810480F11Rik, Dcamkl1, CPG16, Click-I, Dcl, DCLK, 1700113D08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_019978; MGI: 1330861

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6406 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location55242364-55539068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55480406 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 91 (D91G)
Ref Sequence ENSEMBL: ENSMUSP00000142840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054237] [ENSMUST00000070418] [ENSMUST00000196745] [ENSMUST00000198412] [ENSMUST00000198437] [ENSMUST00000199169] [ENSMUST00000199702] [ENSMUST00000200352]
Predicted Effect probably damaging
Transcript: ENSMUST00000054237
AA Change: D414G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050034
Gene: ENSMUSG00000027797
AA Change: D414G

DomainStartEndE-ValueType
DCX 52 143 1.53e-43 SMART
DCX 181 269 2.53e-35 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
S_TKc 406 663 1.71e-104 SMART
low complexity region 736 747 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070418
AA Change: D91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070292
Gene: ENSMUSG00000027797
AA Change: D91G

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 1.71e-104 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196745
AA Change: D398G

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143659
Gene: ENSMUSG00000027797
AA Change: D398G

DomainStartEndE-ValueType
DCX 52 143 7.3e-46 SMART
DCX 181 269 1.2e-37 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
S_TKc 390 646 8.3e-107 SMART
low complexity region 719 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197870
Predicted Effect probably damaging
Transcript: ENSMUST00000198412
AA Change: D91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142637
Gene: ENSMUSG00000027797
AA Change: D91G

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 339 8.1e-107 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198437
AA Change: D107G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143016
Gene: ENSMUSG00000027797
AA Change: D107G

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
S_TKc 99 356 1.71e-104 SMART
low complexity region 429 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198757
Predicted Effect probably damaging
Transcript: ENSMUST00000199169
AA Change: D91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143563
Gene: ENSMUSG00000027797
AA Change: D91G

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 8.5e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199702
AA Change: D90G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143507
Gene: ENSMUSG00000027797
AA Change: D90G

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
S_TKc 82 339 8.5e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200221
Predicted Effect probably damaging
Transcript: ENSMUST00000200352
AA Change: D91G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142840
Gene: ENSMUSG00000027797
AA Change: D91G

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 8.3e-107 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the biological validity of some variants has not been determined. These variants encode different isoforms, which are differentially expressed and have different kinase activities. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a null allele lack the corpus callosum and hippocampal commissure and show aberrant interhemispheric axonal projections. Mice homozygous for a different null allele have normal gross brain architecture but show axonal and dendritic defects following knockdown of Dcx expression. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,506,939 P29L probably benign Het
Acsm1 A G 7: 119,662,261 N567S probably benign Het
Ahi1 T G 10: 20,977,049 N505K probably damaging Het
Ank2 T A 3: 127,032,225 D356V probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifb6 C A 2: 153,904,537 T117K possibly damaging Het
C2cd6 T C 1: 59,058,676 E418G possibly damaging Het
Cbx1 A T 11: 96,801,538 K84* probably null Het
Cr2 A G 1: 195,169,771 L90P probably damaging Het
Dock1 C A 7: 135,145,486 Q1509K probably benign Het
Fzd1 T G 5: 4,756,089 T498P probably damaging Het
Galnt12 A G 4: 47,122,534 N271S probably benign Het
Gm12888 A G 4: 121,319,457 I49T possibly damaging Het
Gria4 A T 9: 4,427,077 W788R probably damaging Het
Ilf3 C T 9: 21,396,244 A379V probably damaging Het
Islr2 A G 9: 58,199,980 V43A probably benign Het
Jag1 T A 2: 137,087,643 N782I probably damaging Het
Klhl8 T A 5: 103,863,115 I539F possibly damaging Het
Lama5 A T 2: 180,197,464 C750* probably null Het
Lrrc37a T A 11: 103,497,535 T2355S unknown Het
Lrrc8a A G 2: 30,257,091 H639R possibly damaging Het
Map1a A T 2: 121,300,743 D442V probably damaging Het
Mier3 T C 13: 111,709,809 probably null Het
Msantd1 C A 5: 34,923,321 probably null Het
Ncapd2 C A 6: 125,173,878 A785S probably benign Het
Ncbp2 CTCGTCTGG C 16: 31,956,341 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Ndst4 T C 3: 125,438,501 S240P probably benign Het
Nek9 T C 12: 85,339,172 D17G probably damaging Het
Nkx6-1 C T 5: 101,663,811 A142T unknown Het
Nt5dc1 T C 10: 34,324,408 H205R probably benign Het
Olfr1012 T A 2: 85,760,307 Q23L possibly damaging Het
Olfr1442 T C 19: 12,674,820 I205T probably benign Het
Pafah1b1 A G 11: 74,682,272 M322T probably benign Het
Parp2 A G 14: 50,819,477 N353D probably benign Het
Pdcd6ip T C 9: 113,674,344 N452S possibly damaging Het
Pkd1l2 A G 8: 117,035,847 V1397A probably damaging Het
Prkdc T A 16: 15,717,801 L1675Q probably damaging Het
Ptprt T C 2: 161,553,783 I1157V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Sele G T 1: 164,050,743 C217F probably damaging Het
Spats1 T A 17: 45,457,265 H125L probably damaging Het
Stard3 T C 11: 98,378,769 V330A probably benign Het
Synj2 T A 17: 6,019,571 probably benign Het
Thoc1 T A 18: 9,977,963 F301L probably damaging Het
Thumpd3 G A 6: 113,055,963 E221K probably damaging Het
Trim61 T C 8: 65,013,725 T295A possibly damaging Het
Trp53bp1 T C 2: 121,270,612 Q35R probably damaging Het
Tsnaxip1 C T 8: 105,843,983 T578I probably benign Het
Other mutations in Dclk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dclk1 APN 3 55247286 missense probably damaging 1.00
IGL02148:Dclk1 APN 3 55500099 missense probably damaging 1.00
IGL02901:Dclk1 APN 3 55487787 splice site probably benign
IGL03086:Dclk1 APN 3 55247367 missense probably damaging 0.96
IGL03213:Dclk1 APN 3 55480384 nonsense probably null
R0037:Dclk1 UTSW 3 55256059 missense probably benign 0.02
R0316:Dclk1 UTSW 3 55502892 missense probably damaging 1.00
R0885:Dclk1 UTSW 3 55487307 missense probably damaging 1.00
R1211:Dclk1 UTSW 3 55380823 missense probably benign 0.05
R1234:Dclk1 UTSW 3 55489877 missense probably damaging 1.00
R1540:Dclk1 UTSW 3 55477823 missense probably damaging 1.00
R1928:Dclk1 UTSW 3 55247521 missense possibly damaging 0.48
R2081:Dclk1 UTSW 3 55521925 critical splice donor site probably null
R2152:Dclk1 UTSW 3 55247212 missense probably damaging 0.97
R2153:Dclk1 UTSW 3 55247212 missense probably damaging 0.97
R2213:Dclk1 UTSW 3 55480433 missense probably damaging 1.00
R3745:Dclk1 UTSW 3 55247442 missense possibly damaging 0.87
R3899:Dclk1 UTSW 3 55247329 missense probably damaging 0.99
R4569:Dclk1 UTSW 3 55247410 missense probably damaging 1.00
R4851:Dclk1 UTSW 3 55480390 missense probably damaging 1.00
R4890:Dclk1 UTSW 3 55521932 missense probably benign
R5105:Dclk1 UTSW 3 55255939 missense probably benign 0.00
R5175:Dclk1 UTSW 3 55247227 missense possibly damaging 0.80
R5364:Dclk1 UTSW 3 55255945 missense possibly damaging 0.95
R5613:Dclk1 UTSW 3 55516939 missense probably benign 0.15
R5819:Dclk1 UTSW 3 55489864 missense probably damaging 0.98
R6113:Dclk1 UTSW 3 55489819 missense probably benign 0.00
R6162:Dclk1 UTSW 3 55256154 missense probably benign 0.02
R6190:Dclk1 UTSW 3 55487811 missense probably damaging 1.00
R6193:Dclk1 UTSW 3 55516871 critical splice acceptor site probably null
R6380:Dclk1 UTSW 3 55247194 missense probably damaging 1.00
R6543:Dclk1 UTSW 3 55500131 missense probably damaging 1.00
R6745:Dclk1 UTSW 3 55477808 missense probably damaging 1.00
R6970:Dclk1 UTSW 3 55466601 intron probably benign
R7037:Dclk1 UTSW 3 55463048 missense probably damaging 1.00
R7086:Dclk1 UTSW 3 55487912 critical splice donor site probably null
R7163:Dclk1 UTSW 3 55256128 nonsense probably null
R7198:Dclk1 UTSW 3 55477875 missense possibly damaging 0.70
Z1088:Dclk1 UTSW 3 55500105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGTCAGTCTGAGCCTGC -3'
(R):5'- TAAAGTCTGTCCTTAGGTGGC -3'

Sequencing Primer
(F):5'- CTGCCGTACTTCTGAGTCAG -3'
(R):5'- AAAGTCTGTCCTTAGGTGGCTTTTC -3'
Posted On2018-05-04