Incidental Mutation 'R6406:Bhlhe40'
ID 516299
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms C130042M06Rik, Clast5, DEC1, CR8, Stra14, cytokine response gene 8, Sharp2, eip1 (E47 interaction protein 1), Bhlhb2, Stra13
MMRRC Submission 044551-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6406 (G1)
Quality Score 217.468
Status Validated
Chromosome 6
Chromosomal Location 108637590-108643886 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TG to TGG at 108641818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change at position 254 (254)
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect probably null
Transcript: ENSMUST00000032194
AA Change: 254
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: 254

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,817,865 (GRCm39) P29L probably benign Het
Acsm1 A G 7: 119,261,484 (GRCm39) N567S probably benign Het
Ahi1 T G 10: 20,852,948 (GRCm39) N505K probably damaging Het
Ank2 T A 3: 126,825,874 (GRCm39) D356V probably damaging Het
Bpifb6 C A 2: 153,746,457 (GRCm39) T117K possibly damaging Het
C2cd6 T C 1: 59,097,835 (GRCm39) E418G possibly damaging Het
Cbx1 A T 11: 96,692,364 (GRCm39) K84* probably null Het
Cr2 A G 1: 194,852,079 (GRCm39) L90P probably damaging Het
Dclk1 A G 3: 55,387,827 (GRCm39) D91G probably damaging Het
Dock1 C A 7: 134,747,215 (GRCm39) Q1509K probably benign Het
Fzd1 T G 5: 4,806,089 (GRCm39) T498P probably damaging Het
Galnt12 A G 4: 47,122,534 (GRCm39) N271S probably benign Het
Gm12888 A G 4: 121,176,654 (GRCm39) I49T possibly damaging Het
Gria4 A T 9: 4,427,077 (GRCm39) W788R probably damaging Het
Ilf3 C T 9: 21,307,540 (GRCm39) A379V probably damaging Het
Islr2 A G 9: 58,107,263 (GRCm39) V43A probably benign Het
Jag1 T A 2: 136,929,563 (GRCm39) N782I probably damaging Het
Klhl8 T A 5: 104,010,981 (GRCm39) I539F possibly damaging Het
Lama5 A T 2: 179,839,257 (GRCm39) C750* probably null Het
Lrrc37a T A 11: 103,388,361 (GRCm39) T2355S unknown Het
Lrrc8a A G 2: 30,147,103 (GRCm39) H639R possibly damaging Het
Map1a A T 2: 121,131,224 (GRCm39) D442V probably damaging Het
Mier3 T C 13: 111,846,343 (GRCm39) probably null Het
Msantd1 C A 5: 35,080,665 (GRCm39) probably null Het
Ncapd2 C A 6: 125,150,841 (GRCm39) A785S probably benign Het
Ncbp2 CTCGTCTGG C 16: 31,775,159 (GRCm39) probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,775,161 (GRCm39) probably null Het
Ndst4 T C 3: 125,232,150 (GRCm39) S240P probably benign Het
Nek9 T C 12: 85,385,946 (GRCm39) D17G probably damaging Het
Nkx6-1 C T 5: 101,811,677 (GRCm39) A142T unknown Het
Nt5dc1 T C 10: 34,200,404 (GRCm39) H205R probably benign Het
Or5b94 T C 19: 12,652,184 (GRCm39) I205T probably benign Het
Or9g3 T A 2: 85,590,651 (GRCm39) Q23L possibly damaging Het
Pafah1b1 A G 11: 74,573,098 (GRCm39) M322T probably benign Het
Parp2 A G 14: 51,056,934 (GRCm39) N353D probably benign Het
Pdcd6ip T C 9: 113,503,412 (GRCm39) N452S possibly damaging Het
Pkd1l2 A G 8: 117,762,586 (GRCm39) V1397A probably damaging Het
Prkdc T A 16: 15,535,665 (GRCm39) L1675Q probably damaging Het
Ptprt T C 2: 161,395,703 (GRCm39) I1157V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,133 (GRCm39) probably benign Het
Sele G T 1: 163,878,312 (GRCm39) C217F probably damaging Het
Spats1 T A 17: 45,768,191 (GRCm39) H125L probably damaging Het
Stard3 T C 11: 98,269,595 (GRCm39) V330A probably benign Het
Synj2 T A 17: 6,069,846 (GRCm39) probably benign Het
Thoc1 T A 18: 9,977,963 (GRCm39) F301L probably damaging Het
Thumpd3 G A 6: 113,032,924 (GRCm39) E221K probably damaging Het
Trim61 T C 8: 65,466,377 (GRCm39) T295A possibly damaging Het
Trp53bp1 T C 2: 121,101,093 (GRCm39) Q35R probably damaging Het
Tsnaxip1 C T 8: 106,570,615 (GRCm39) T578I probably benign Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108,638,139 (GRCm39) missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108,641,901 (GRCm39) missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108,641,503 (GRCm39) missense probably damaging 1.00
teedoff UTSW 6 108,641,818 (GRCm39) frame shift probably null
R0360:Bhlhe40 UTSW 6 108,641,711 (GRCm39) missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108,641,890 (GRCm39) missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108,639,546 (GRCm39) missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108,642,169 (GRCm39) missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108,642,154 (GRCm39) missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108,641,423 (GRCm39) splice site probably null
R6283:Bhlhe40 UTSW 6 108,641,992 (GRCm39) missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6595:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6654:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6656:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6657:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6659:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6734:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6968:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7105:Bhlhe40 UTSW 6 108,641,997 (GRCm39) missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108,642,242 (GRCm39) missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7399:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7472:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7563:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7726:Bhlhe40 UTSW 6 108,639,559 (GRCm39) missense probably benign
R8058:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8319:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8320:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8380:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8381:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8428:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8431:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8432:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8988:Bhlhe40 UTSW 6 108,639,518 (GRCm39) missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108,642,244 (GRCm39) missense probably damaging 1.00
R9582:Bhlhe40 UTSW 6 108,638,467 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAATCTTCCCAGCTCGTCAC -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On 2018-05-04