Incidental Mutation 'R6406:Ncbp2'
ID516322
Institutional Source Beutler Lab
Gene Symbol Ncbp2
Ensembl Gene ENSMUSG00000022774
Gene Namenuclear cap binding protein subunit 2
Synonyms20kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6406 (G1)
Quality Score164.468
Status Validated
Chromosome16
Chromosomal Location31948513-31961781 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTCGTCTGG to C at 31956341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023460] [ENSMUST00000115178] [ENSMUST00000126215] [ENSMUST00000231360]
Predicted Effect probably null
Transcript: ENSMUST00000023460
SMART Domains Protein: ENSMUSP00000023460
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
RRM 41 114 6.96e-23 SMART
low complexity region 122 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115178
SMART Domains Protein: ENSMUSP00000110832
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
PDB:3FEY|B 1 103 7e-42 PDB
Blast:RRM 41 61 2e-6 BLAST
SCOP:d1qm9a1 41 97 4e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140965
Predicted Effect probably benign
Transcript: ENSMUST00000231360
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,506,939 P29L probably benign Het
Acsm1 A G 7: 119,662,261 N567S probably benign Het
Ahi1 T G 10: 20,977,049 N505K probably damaging Het
Ank2 T A 3: 127,032,225 D356V probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifb6 C A 2: 153,904,537 T117K possibly damaging Het
C2cd6 T C 1: 59,058,676 E418G possibly damaging Het
Cbx1 A T 11: 96,801,538 K84* probably null Het
Cr2 A G 1: 195,169,771 L90P probably damaging Het
Dclk1 A G 3: 55,480,406 D91G probably damaging Het
Dock1 C A 7: 135,145,486 Q1509K probably benign Het
Fzd1 T G 5: 4,756,089 T498P probably damaging Het
Galnt12 A G 4: 47,122,534 N271S probably benign Het
Gm12888 A G 4: 121,319,457 I49T possibly damaging Het
Gria4 A T 9: 4,427,077 W788R probably damaging Het
Ilf3 C T 9: 21,396,244 A379V probably damaging Het
Islr2 A G 9: 58,199,980 V43A probably benign Het
Jag1 T A 2: 137,087,643 N782I probably damaging Het
Klhl8 T A 5: 103,863,115 I539F possibly damaging Het
Lama5 A T 2: 180,197,464 C750* probably null Het
Lrrc37a T A 11: 103,497,535 T2355S unknown Het
Lrrc8a A G 2: 30,257,091 H639R possibly damaging Het
Map1a A T 2: 121,300,743 D442V probably damaging Het
Mier3 T C 13: 111,709,809 probably null Het
Msantd1 C A 5: 34,923,321 probably null Het
Ncapd2 C A 6: 125,173,878 A785S probably benign Het
Ndst4 T C 3: 125,438,501 S240P probably benign Het
Nek9 T C 12: 85,339,172 D17G probably damaging Het
Nkx6-1 C T 5: 101,663,811 A142T unknown Het
Nt5dc1 T C 10: 34,324,408 H205R probably benign Het
Olfr1012 T A 2: 85,760,307 Q23L possibly damaging Het
Olfr1442 T C 19: 12,674,820 I205T probably benign Het
Pafah1b1 A G 11: 74,682,272 M322T probably benign Het
Parp2 A G 14: 50,819,477 N353D probably benign Het
Pdcd6ip T C 9: 113,674,344 N452S possibly damaging Het
Pkd1l2 A G 8: 117,035,847 V1397A probably damaging Het
Prkdc T A 16: 15,717,801 L1675Q probably damaging Het
Ptprt T C 2: 161,553,783 I1157V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Sele G T 1: 164,050,743 C217F probably damaging Het
Spats1 T A 17: 45,457,265 H125L probably damaging Het
Stard3 T C 11: 98,378,769 V330A probably benign Het
Synj2 T A 17: 6,019,571 probably benign Het
Thoc1 T A 18: 9,977,963 F301L probably damaging Het
Thumpd3 G A 6: 113,055,963 E221K probably damaging Het
Trim61 T C 8: 65,013,725 T295A possibly damaging Het
Trp53bp1 T C 2: 121,270,612 Q35R probably damaging Het
Tsnaxip1 C T 8: 105,843,983 T578I probably benign Het
Other mutations in Ncbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02875:Ncbp2 APN 16 31954153 missense probably damaging 1.00
R1929:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2185:Ncbp2 UTSW 16 31956377 missense probably damaging 1.00
R2270:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2271:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R2272:Ncbp2 UTSW 16 31956951 missense probably damaging 0.99
R6405:Ncbp2 UTSW 16 31956343 frame shift probably null
R6406:Ncbp2 UTSW 16 31956343 frame shift probably null
R6444:Ncbp2 UTSW 16 31956343 frame shift probably null
R6446:Ncbp2 UTSW 16 31956343 frame shift probably null
R6448:Ncbp2 UTSW 16 31956343 frame shift probably null
R6530:Ncbp2 UTSW 16 31956343 frame shift probably null
R6531:Ncbp2 UTSW 16 31956343 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGCCCAGAAGTCGTGTTAGA -3'
(R):5'- CACTAACAAGCACAAGTTCCTT -3'

Sequencing Primer
(F):5'- CCAGAAGTCGTGTTAGACCAACTTTG -3'
(R):5'- TAACAAGCACAAGTTCCTTACAAAAG -3'
Posted On2018-05-04