Incidental Mutation 'R6406:Aars2'
ID516326
Institutional Source Beutler Lab
Gene Symbol Aars2
Ensembl Gene ENSMUSG00000023938
Gene Namealanyl-tRNA synthetase 2, mitochondrial
SynonymsAarsl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R6406 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location45506841-45520842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45506939 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 29 (P29L)
Ref Sequence ENSEMBL: ENSMUSP00000024733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024733]
Predicted Effect probably benign
Transcript: ENSMUST00000024733
AA Change: P29L

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024733
Gene: ENSMUSG00000023938
AA Change: P29L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:tRNA-synt_2c 36 619 4e-175 PFAM
low complexity region 663 674 N/A INTRINSIC
tRNA_SAD 716 774 2.65e-10 SMART
coiled coil region 833 863 N/A INTRINSIC
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. Aminoacyl-tRNA synthetases play critical roles in mRNA translation by charging tRNAs with their cognate amino acids. The encoded protein is a mitochondrial enzyme that specifically aminoacylates alanyl-tRNA. Mutations in this gene are a cause of combined oxidative phosphorylation deficiency 8. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,662,261 N567S probably benign Het
Ahi1 T G 10: 20,977,049 N505K probably damaging Het
Ank2 T A 3: 127,032,225 D356V probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifb6 C A 2: 153,904,537 T117K possibly damaging Het
C2cd6 T C 1: 59,058,676 E418G possibly damaging Het
Cbx1 A T 11: 96,801,538 K84* probably null Het
Cr2 A G 1: 195,169,771 L90P probably damaging Het
Dclk1 A G 3: 55,480,406 D91G probably damaging Het
Dock1 C A 7: 135,145,486 Q1509K probably benign Het
Fzd1 T G 5: 4,756,089 T498P probably damaging Het
Galnt12 A G 4: 47,122,534 N271S probably benign Het
Gm12888 A G 4: 121,319,457 I49T possibly damaging Het
Gria4 A T 9: 4,427,077 W788R probably damaging Het
Ilf3 C T 9: 21,396,244 A379V probably damaging Het
Islr2 A G 9: 58,199,980 V43A probably benign Het
Jag1 T A 2: 137,087,643 N782I probably damaging Het
Klhl8 T A 5: 103,863,115 I539F possibly damaging Het
Lama5 A T 2: 180,197,464 C750* probably null Het
Lrrc37a T A 11: 103,497,535 T2355S unknown Het
Lrrc8a A G 2: 30,257,091 H639R possibly damaging Het
Map1a A T 2: 121,300,743 D442V probably damaging Het
Mier3 T C 13: 111,709,809 probably null Het
Msantd1 C A 5: 34,923,321 probably null Het
Ncapd2 C A 6: 125,173,878 A785S probably benign Het
Ncbp2 CTCGTCTGG C 16: 31,956,341 probably null Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Ndst4 T C 3: 125,438,501 S240P probably benign Het
Nek9 T C 12: 85,339,172 D17G probably damaging Het
Nkx6-1 C T 5: 101,663,811 A142T unknown Het
Nt5dc1 T C 10: 34,324,408 H205R probably benign Het
Olfr1012 T A 2: 85,760,307 Q23L possibly damaging Het
Olfr1442 T C 19: 12,674,820 I205T probably benign Het
Pafah1b1 A G 11: 74,682,272 M322T probably benign Het
Parp2 A G 14: 50,819,477 N353D probably benign Het
Pdcd6ip T C 9: 113,674,344 N452S possibly damaging Het
Pkd1l2 A G 8: 117,035,847 V1397A probably damaging Het
Prkdc T A 16: 15,717,801 L1675Q probably damaging Het
Ptprt T C 2: 161,553,783 I1157V probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Sele G T 1: 164,050,743 C217F probably damaging Het
Spats1 T A 17: 45,457,265 H125L probably damaging Het
Stard3 T C 11: 98,378,769 V330A probably benign Het
Synj2 T A 17: 6,019,571 probably benign Het
Thoc1 T A 18: 9,977,963 F301L probably damaging Het
Thumpd3 G A 6: 113,055,963 E221K probably damaging Het
Trim61 T C 8: 65,013,725 T295A possibly damaging Het
Trp53bp1 T C 2: 121,270,612 Q35R probably damaging Het
Tsnaxip1 C T 8: 105,843,983 T578I probably benign Het
Other mutations in Aars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02958:Aars2 APN 17 45518172 missense probably benign 0.00
dread_pirate UTSW 17 45516564 missense probably damaging 1.00
R0266:Aars2 UTSW 17 45507510 splice site probably benign
R0315:Aars2 UTSW 17 45515452 missense possibly damaging 0.67
R0375:Aars2 UTSW 17 45514550 missense probably damaging 0.99
R0629:Aars2 UTSW 17 45507547 missense probably damaging 0.99
R0981:Aars2 UTSW 17 45520331 missense probably damaging 1.00
R1878:Aars2 UTSW 17 45514638 critical splice donor site probably null
R1893:Aars2 UTSW 17 45514799 missense probably benign 0.14
R2035:Aars2 UTSW 17 45514801 missense possibly damaging 0.87
R2099:Aars2 UTSW 17 45506894 missense unknown
R4342:Aars2 UTSW 17 45516495 missense probably benign
R4600:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R4601:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R4610:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R5158:Aars2 UTSW 17 45514829 missense probably benign 0.07
R5943:Aars2 UTSW 17 45517711 missense probably benign 0.30
R5992:Aars2 UTSW 17 45508623 nonsense probably null
R6255:Aars2 UTSW 17 45514609 missense probably damaging 1.00
R6381:Aars2 UTSW 17 45518545 missense probably benign 0.04
R6392:Aars2 UTSW 17 45514600 missense probably damaging 0.98
R6648:Aars2 UTSW 17 45516564 missense probably damaging 1.00
R7135:Aars2 UTSW 17 45508961 nonsense probably null
R7197:Aars2 UTSW 17 45508959 missense probably damaging 1.00
R7203:Aars2 UTSW 17 45516571 missense probably damaging 1.00
R7289:Aars2 UTSW 17 45507624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTAGAAGCTGAGACTTGCCC -3'
(R):5'- TTTTCTCAGGCTGACTCCCGAG -3'

Sequencing Primer
(F):5'- CCAAGTCTTCCACCCGC -3'
(R):5'- TGACTCCCGAGCTCCGC -3'
Posted On2018-05-04