Incidental Mutation 'R6451:Rnf216'
ID 516340
Institutional Source Beutler Lab
Gene Symbol Rnf216
Ensembl Gene ENSMUSG00000045078
Gene Name ring finger protein 216
Synonyms 2810055G22Rik, F830018F18Rik, UIP83, Ubce7ip1
MMRRC Submission 044587-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6451 (G1)
Quality Score 197.009
Status Validated
Chromosome 5
Chromosomal Location 142976648-143098749 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 142978589 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 793 (P793T)
Ref Sequence ENSEMBL: ENSMUSP00000052563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]
AlphaFold P58283
Predicted Effect possibly damaging
Transcript: ENSMUST00000053498
AA Change: P793T

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078
AA Change: P793T

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197296
Predicted Effect probably benign
Transcript: ENSMUST00000200430
Predicted Effect possibly damaging
Transcript: ENSMUST00000200607
AA Change: P850T

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: P850T

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,842,733 (GRCm39) V1164E probably damaging Het
Acnat2 A G 4: 49,380,262 (GRCm39) V372A probably benign Het
Adam17 A T 12: 21,392,883 (GRCm39) D313E probably benign Het
Adgrf5 A T 17: 43,735,709 (GRCm39) R200* probably null Het
Akr1d1 G A 6: 37,527,150 (GRCm39) E129K probably benign Het
Arhgap29 T A 3: 121,787,230 (GRCm39) V382E probably damaging Het
Arhgef40 G A 14: 52,238,456 (GRCm39) V1312I probably damaging Het
Bbs9 A G 9: 22,479,060 (GRCm39) S168G probably damaging Het
Carmil1 T A 13: 24,276,541 (GRCm39) K202* probably null Het
Cnep1r1 A G 8: 88,846,438 (GRCm39) E19G probably damaging Het
Dnah1 T A 14: 31,022,765 (GRCm39) Q1124L probably benign Het
Dph1 G T 11: 75,072,143 (GRCm39) A242D probably damaging Het
Efcab7 T A 4: 99,719,738 (GRCm39) Y73* probably null Het
Esp18 G T 17: 39,720,853 (GRCm39) E33* probably null Het
Fbln2 T A 6: 91,211,241 (GRCm39) I395K probably benign Het
Grin3a C T 4: 49,844,969 (GRCm39) C38Y probably damaging Het
Hivep3 T A 4: 119,956,105 (GRCm39) S1474T probably benign Het
Hmcn1 C T 1: 150,868,670 (GRCm39) V45M probably damaging Het
Intu T A 3: 40,655,723 (GRCm39) F937I possibly damaging Het
Llgl2 G A 11: 115,735,767 (GRCm39) G121D probably damaging Het
Myo7a C T 7: 97,722,374 (GRCm39) V1184M probably benign Het
Nsmce4a G T 7: 130,144,479 (GRCm39) Het
Or5w20 T C 2: 87,726,935 (GRCm39) Y131H probably damaging Het
Or6c69c A T 10: 129,911,007 (GRCm39) M243L probably benign Het
Phactr1 T A 13: 43,286,469 (GRCm39) V590E probably damaging Het
Pigo G A 4: 43,021,412 (GRCm39) S510L probably benign Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Rnf19a A G 15: 36,253,205 (GRCm39) I378T possibly damaging Het
Samd8 T C 14: 21,833,866 (GRCm39) probably null Het
Son T A 16: 91,454,490 (GRCm39) M1079K probably damaging Het
Spata7 T A 12: 98,624,596 (GRCm39) M166K probably benign Het
Spta1 G A 1: 174,044,767 (GRCm39) E1468K probably damaging Het
Taar3 A T 10: 23,825,705 (GRCm39) I84F possibly damaging Het
Tas2r107 T A 6: 131,636,977 (GRCm39) D24V possibly damaging Het
Tmc2 A G 2: 130,106,123 (GRCm39) R885G probably damaging Het
Tox3 C A 8: 90,984,687 (GRCm39) R164L probably benign Het
Ttc5 A G 14: 51,004,664 (GRCm39) I380T probably damaging Het
Vmn1r179 A G 7: 23,628,076 (GRCm39) N89S possibly damaging Het
Zfp944 T C 17: 22,557,846 (GRCm39) E467G probably benign Het
Zzef1 A T 11: 72,813,982 (GRCm39) D2857V possibly damaging Het
Other mutations in Rnf216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Rnf216 APN 5 143,054,665 (GRCm39) missense possibly damaging 0.67
IGL02502:Rnf216 APN 5 143,054,622 (GRCm39) missense probably damaging 1.00
IGL02536:Rnf216 APN 5 143,065,995 (GRCm39) missense probably benign 0.04
IGL03196:Rnf216 APN 5 143,066,766 (GRCm39) missense probably damaging 1.00
PIT4445001:Rnf216 UTSW 5 143,071,758 (GRCm39) missense probably damaging 1.00
R0270:Rnf216 UTSW 5 143,065,996 (GRCm39) missense possibly damaging 0.63
R0422:Rnf216 UTSW 5 143,076,125 (GRCm39) missense probably benign 0.15
R0422:Rnf216 UTSW 5 143,001,409 (GRCm39) nonsense probably null
R0782:Rnf216 UTSW 5 143,054,647 (GRCm39) missense possibly damaging 0.64
R1109:Rnf216 UTSW 5 143,054,124 (GRCm39) missense probably damaging 1.00
R1917:Rnf216 UTSW 5 142,978,561 (GRCm39) missense probably benign 0.03
R2233:Rnf216 UTSW 5 143,076,681 (GRCm39) missense probably benign
R2234:Rnf216 UTSW 5 143,076,681 (GRCm39) missense probably benign
R2235:Rnf216 UTSW 5 143,076,681 (GRCm39) missense probably benign
R2340:Rnf216 UTSW 5 143,066,089 (GRCm39) missense probably damaging 0.99
R3015:Rnf216 UTSW 5 143,061,480 (GRCm39) critical splice donor site probably null
R3726:Rnf216 UTSW 5 143,013,701 (GRCm39) missense probably damaging 0.96
R4231:Rnf216 UTSW 5 143,078,845 (GRCm39) missense probably damaging 1.00
R4885:Rnf216 UTSW 5 143,076,335 (GRCm39) nonsense probably null
R4942:Rnf216 UTSW 5 143,078,814 (GRCm39) missense probably damaging 1.00
R4973:Rnf216 UTSW 5 143,076,071 (GRCm39) missense probably benign
R5291:Rnf216 UTSW 5 143,075,967 (GRCm39) missense probably benign
R5307:Rnf216 UTSW 5 143,078,757 (GRCm39) missense probably damaging 1.00
R5328:Rnf216 UTSW 5 143,078,754 (GRCm39) missense possibly damaging 0.84
R5416:Rnf216 UTSW 5 143,001,526 (GRCm39) nonsense probably null
R5888:Rnf216 UTSW 5 143,054,069 (GRCm39) splice site probably null
R6048:Rnf216 UTSW 5 143,054,659 (GRCm39) missense probably damaging 1.00
R6595:Rnf216 UTSW 5 143,076,412 (GRCm39) missense probably benign 0.00
R7422:Rnf216 UTSW 5 143,076,591 (GRCm39) missense probably benign 0.01
R7470:Rnf216 UTSW 5 142,978,480 (GRCm39) missense possibly damaging 0.88
R7504:Rnf216 UTSW 5 143,061,514 (GRCm39) missense probably benign 0.27
R7507:Rnf216 UTSW 5 143,075,557 (GRCm39) missense probably damaging 1.00
R7695:Rnf216 UTSW 5 143,071,659 (GRCm39) missense possibly damaging 0.80
R7757:Rnf216 UTSW 5 143,065,991 (GRCm39) missense probably damaging 1.00
R7768:Rnf216 UTSW 5 143,084,199 (GRCm39) start codon destroyed probably null 1.00
R8056:Rnf216 UTSW 5 142,978,616 (GRCm39) missense probably benign 0.02
R8081:Rnf216 UTSW 5 143,013,719 (GRCm39) missense probably damaging 0.98
R8985:Rnf216 UTSW 5 143,076,180 (GRCm39) missense probably benign 0.16
Z1176:Rnf216 UTSW 5 143,084,198 (GRCm39) start codon destroyed probably null 0.99
Z1177:Rnf216 UTSW 5 142,978,562 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGGTGTCAGAAGCGATGC -3'
(R):5'- TCAGAAGTGGCATGCAGAGC -3'

Sequencing Primer
(F):5'- CAGAAGCGATGCCGTGGTTG -3'
(R):5'- TAGTCAGGCAAGCATCTGC -3'
Posted On 2018-05-21