Incidental Mutation 'R6451:Taar3'
ID516350
Institutional Source Beutler Lab
Gene Symbol Taar3
Ensembl Gene ENSMUSG00000069708
Gene Nametrace amine-associated receptor 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6451 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location23949558-23950589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23949807 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 84 (I84F)
Ref Sequence ENSEMBL: ENSMUSP00000036817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045152]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045152
AA Change: I84F

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036817
Gene: ENSMUSG00000069708
AA Change: I84F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 320 1.8e-13 PFAM
Pfam:7tm_1 48 309 1.4e-53 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,006,899 V1164E probably damaging Het
Acnat2 A G 4: 49,380,262 V372A probably benign Het
Adam17 A T 12: 21,342,882 D313E probably benign Het
Adgrf5 A T 17: 43,424,818 R200* probably null Het
Akr1d1 G A 6: 37,550,215 E129K probably benign Het
Arhgap29 T A 3: 121,993,581 V382E probably damaging Het
Arhgef40 G A 14: 52,000,999 V1312I probably damaging Het
Bbs9 A G 9: 22,567,764 S168G probably damaging Het
Carmil1 T A 13: 24,092,558 K202* probably null Het
Cnep1r1 A G 8: 88,119,810 E19G probably damaging Het
Dnah1 T A 14: 31,300,808 Q1124L probably benign Het
Dph1 G T 11: 75,181,317 A242D probably damaging Het
Efcab7 T A 4: 99,831,501 Y73* probably null Het
Esp18 G T 17: 39,409,962 E33* probably null Het
Fbln2 T A 6: 91,234,259 I395K probably benign Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Grin3a C T 4: 49,844,969 C38Y probably damaging Het
Hivep3 T A 4: 120,098,908 S1474T probably benign Het
Hmcn1 C T 1: 150,992,919 V45M probably damaging Het
Intu T A 3: 40,701,293 F937I possibly damaging Het
Llgl2 G A 11: 115,844,941 G121D probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nsmce4a G T 7: 130,542,749 Het
Olfr1153 T C 2: 87,896,591 Y131H probably damaging Het
Olfr822 A T 10: 130,075,138 M243L probably benign Het
Phactr1 T A 13: 43,132,993 V590E probably damaging Het
Pigo G A 4: 43,021,412 S510L probably benign Het
Rnf19a A G 15: 36,253,059 I378T possibly damaging Het
Rnf216 G T 5: 142,992,834 P793T possibly damaging Het
Samd8 T C 14: 21,783,798 probably null Het
Son T A 16: 91,657,602 M1079K probably damaging Het
Spata7 T A 12: 98,658,337 M166K probably benign Het
Spta1 G A 1: 174,217,201 E1468K probably damaging Het
Tas2r107 T A 6: 131,660,014 D24V possibly damaging Het
Tmc2 A G 2: 130,264,203 R885G probably damaging Het
Tox3 C A 8: 90,258,059 R164L probably benign Het
Ttc5 A G 14: 50,767,207 I380T probably damaging Het
Vmn1r179 A G 7: 23,928,651 N89S possibly damaging Het
Zfp944 T C 17: 22,338,865 E467G probably benign Het
Zzef1 A T 11: 72,923,156 D2857V possibly damaging Het
Other mutations in Taar3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Taar3 APN 10 23950432 missense probably damaging 1.00
IGL01777:Taar3 APN 10 23950005 missense probably benign 0.39
IGL01940:Taar3 APN 10 23949957 missense probably damaging 1.00
IGL02120:Taar3 APN 10 23950167 missense probably benign 0.33
PIT4445001:Taar3 UTSW 10 23949688 missense possibly damaging 0.85
R0582:Taar3 UTSW 10 23949817 missense probably damaging 1.00
R1925:Taar3 UTSW 10 23950585 missense probably benign 0.22
R2261:Taar3 UTSW 10 23950155 missense probably benign 0.00
R4088:Taar3 UTSW 10 23949859 missense possibly damaging 0.46
R4504:Taar3 UTSW 10 23949573 missense possibly damaging 0.84
R4505:Taar3 UTSW 10 23949573 missense possibly damaging 0.84
R4507:Taar3 UTSW 10 23949573 missense possibly damaging 0.84
R4925:Taar3 UTSW 10 23950543 missense probably damaging 0.99
R6221:Taar3 UTSW 10 23950072 missense possibly damaging 0.92
X0057:Taar3 UTSW 10 23949646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CGAAGACTTATCCAGCTGTCC -3'
(R):5'- GGTGTAGTGCAAAGGGTCAC -3'

Sequencing Primer
(F):5'- ATTTGGAAATAAATCCTGCCCTCC -3'
(R):5'- GTGCAAAGGGTCACACACTGC -3'
Posted On2018-05-21