Incidental Mutation 'R6472:Kif16b'
ID516376
Institutional Source Beutler Lab
Gene Symbol Kif16b
Ensembl Gene ENSMUSG00000038844
Gene Namekinesin family member 16B
Synonyms8430434E15Rik, N-3 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6472 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location142617474-142901531 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 142699948 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]
Predicted Effect probably benign
Transcript: ENSMUST00000043589
SMART Domains Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844

DomainStartEndE-ValueType
KISc 1 366 4.87e-173 SMART
FHA 477 529 1.43e-1 SMART
coiled coil region 597 809 N/A INTRINSIC
coiled coil region 835 858 N/A INTRINSIC
coiled coil region 941 1022 N/A INTRINSIC
PX 1179 1281 1.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211861
Predicted Effect unknown
Transcript: ENSMUST00000212106
AA Change: T476K
Predicted Effect probably benign
Transcript: ENSMUST00000230763
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.4%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A T 16: 91,056,003 S82T probably benign Het
Abca1 A G 4: 53,085,991 probably null Het
Ascc3 T C 10: 50,720,687 Y1238H probably benign Het
BC003331 C T 1: 150,381,522 D230N probably benign Het
Cdadc1 T C 14: 59,586,042 T334A probably damaging Het
Csrp3 G A 7: 48,835,608 T47I possibly damaging Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
Fads6 T C 11: 115,286,136 T165A probably damaging Het
Fbxo30 T C 10: 11,291,231 S566P probably damaging Het
Gsn A G 2: 35,290,451 probably null Het
Heatr1 A G 13: 12,434,230 D1897G probably benign Het
Il2ra G A 2: 11,681,969 E204K possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Nov A T 15: 54,749,272 T226S possibly damaging Het
Olfr223 G A 11: 59,589,756 T111I probably benign Het
Olfr228 A T 2: 86,483,190 L184* probably null Het
Olfr434 A G 6: 43,217,359 I149V probably benign Het
Olfr837 T A 9: 19,137,415 C141S probably damaging Het
Pappa2 T C 1: 158,834,799 D1202G probably damaging Het
Pcp4l1 A T 1: 171,174,435 I52N possibly damaging Het
Sis C T 3: 72,938,734 W665* probably null Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Snrpb2 A G 2: 143,068,301 K93R possibly damaging Het
Syt10 T G 15: 89,814,558 E194D probably benign Het
Tmem163 A C 1: 127,495,734 F264V probably benign Het
Trav3-1 G T 14: 52,581,050 E60D possibly damaging Het
Vmn1r237 G A 17: 21,314,354 S113N probably benign Het
Vwa8 T C 14: 79,009,170 S651P possibly damaging Het
Wnt3 G A 11: 103,808,274 V69I possibly damaging Het
Other mutations in Kif16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kif16b APN 2 142848035 nonsense probably null
IGL00499:Kif16b APN 2 142857324 missense probably damaging 1.00
IGL00913:Kif16b APN 2 142704007 nonsense probably null
IGL00971:Kif16b APN 2 142711744 missense probably benign 0.01
IGL01712:Kif16b APN 2 142648471 missense probably damaging 1.00
IGL01965:Kif16b APN 2 142848405 missense probably damaging 1.00
IGL02428:Kif16b APN 2 142672360 missense possibly damaging 0.88
IGL02576:Kif16b APN 2 142862545 splice site probably benign
IGL02884:Kif16b APN 2 142702614 splice site probably benign
IGL03065:Kif16b APN 2 142619913 missense probably damaging 1.00
IGL03103:Kif16b APN 2 142862488 missense probably damaging 1.00
IGL03403:Kif16b APN 2 142711869 missense probably damaging 1.00
IGL02835:Kif16b UTSW 2 142712213 missense probably benign 0.00
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0081:Kif16b UTSW 2 142707426 splice site probably benign
R0123:Kif16b UTSW 2 142672375 missense probably benign
R0134:Kif16b UTSW 2 142672375 missense probably benign
R0388:Kif16b UTSW 2 142740937 missense probably damaging 1.00
R0396:Kif16b UTSW 2 142853659 missense probably damaging 1.00
R0502:Kif16b UTSW 2 142712155 missense probably benign 0.00
R1027:Kif16b UTSW 2 142854538 splice site probably benign
R1674:Kif16b UTSW 2 142712953 nonsense probably null
R1752:Kif16b UTSW 2 142690666 missense probably benign 0.01
R2154:Kif16b UTSW 2 142690580 missense probably damaging 1.00
R2262:Kif16b UTSW 2 142740917 missense probably damaging 1.00
R2401:Kif16b UTSW 2 142756122 missense probably benign 0.04
R3951:Kif16b UTSW 2 142707359 missense probably benign 0.01
R4161:Kif16b UTSW 2 142707404 missense probably benign 0.00
R4697:Kif16b UTSW 2 142690694 missense probably benign 0.09
R4747:Kif16b UTSW 2 142857426 missense probably damaging 1.00
R4808:Kif16b UTSW 2 142857358 missense probably damaging 1.00
R4878:Kif16b UTSW 2 142848003 missense probably damaging 1.00
R5068:Kif16b UTSW 2 142711707 missense probably benign
R5120:Kif16b UTSW 2 142848339 missense probably damaging 1.00
R5358:Kif16b UTSW 2 142740969 missense probably damaging 1.00
R5821:Kif16b UTSW 2 142702666 missense probably damaging 1.00
R5833:Kif16b UTSW 2 142707367 missense probably benign
R5882:Kif16b UTSW 2 142707258 critical splice donor site probably null
R5974:Kif16b UTSW 2 142857381 missense probably damaging 1.00
R6043:Kif16b UTSW 2 142711900 missense probably damaging 1.00
R6230:Kif16b UTSW 2 142849912 missense probably damaging 1.00
R6373:Kif16b UTSW 2 142699698 missense possibly damaging 0.91
R6622:Kif16b UTSW 2 142712442 missense probably benign 0.01
R6654:Kif16b UTSW 2 142701277 intron probably benign
R6912:Kif16b UTSW 2 142700099 intron probably benign
R7003:Kif16b UTSW 2 142758829 missense possibly damaging 0.95
R7265:Kif16b UTSW 2 142714730 missense probably damaging 1.00
R7307:Kif16b UTSW 2 142712931 missense probably benign 0.00
X0058:Kif16b UTSW 2 142758861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAACTCCATTCGCCAAAG -3'
(R):5'- CATTTACTGGCTTGCAGTTGC -3'

Sequencing Primer
(F):5'- GCTAAAACAGGGATTTCTGCC -3'
(R):5'- AGTTGCTAACTGCTCCCAG -3'
Posted On2018-05-21