Incidental Mutation 'R6472:Fbxo30'
ID516386
Institutional Source Beutler Lab
Gene Symbol Fbxo30
Ensembl Gene ENSMUSG00000047648
Gene NameF-box protein 30
SynonymsFbx30
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_027968.3, NM_001168297.1; MGI: 1919115

Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R6472 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location11281330-11298052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11291231 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 566 (S566P)
Ref Sequence ENSEMBL: ENSMUSP00000117687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070300] [ENSMUST00000129456]
Predicted Effect probably damaging
Transcript: ENSMUST00000070300
AA Change: S566P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068230
Gene: ENSMUSG00000047648
AA Change: S566P

DomainStartEndE-ValueType
Pfam:zf-TRAF_2 8 100 2.5e-42 PFAM
Pfam:F-box_4 610 725 1.6e-52 PFAM
Pfam:F-box 612 653 3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129456
AA Change: S566P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117687
Gene: ENSMUSG00000047648
AA Change: S566P

DomainStartEndE-ValueType
PDB:2YRE|A 1 88 6e-51 PDB
SCOP:d1k2fa_ 58 93 7e-3 SMART
Pfam:F-box 612 653 2.3e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.3%
  • 20x: 94.4%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it is upregulated in nasopharyngeal carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik A T 16: 91,056,003 S82T probably benign Het
Abca1 A G 4: 53,085,991 probably null Het
Ascc3 T C 10: 50,720,687 Y1238H probably benign Het
BC003331 C T 1: 150,381,522 D230N probably benign Het
Cdadc1 T C 14: 59,586,042 T334A probably damaging Het
Csrp3 G A 7: 48,835,608 T47I possibly damaging Het
Cyp2f2 G A 7: 27,129,224 R173H probably damaging Het
Fads6 T C 11: 115,286,136 T165A probably damaging Het
Gsn A G 2: 35,290,451 probably null Het
Heatr1 A G 13: 12,434,230 D1897G probably benign Het
Il2ra G A 2: 11,681,969 E204K possibly damaging Het
Kif16b G T 2: 142,699,948 probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Nov A T 15: 54,749,272 T226S possibly damaging Het
Olfr223 G A 11: 59,589,756 T111I probably benign Het
Olfr228 A T 2: 86,483,190 L184* probably null Het
Olfr434 A G 6: 43,217,359 I149V probably benign Het
Olfr837 T A 9: 19,137,415 C141S probably damaging Het
Pappa2 T C 1: 158,834,799 D1202G probably damaging Het
Pcp4l1 A T 1: 171,174,435 I52N possibly damaging Het
Sis C T 3: 72,938,734 W665* probably null Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Snrpb2 A G 2: 143,068,301 K93R possibly damaging Het
Syt10 T G 15: 89,814,558 E194D probably benign Het
Tmem163 A C 1: 127,495,734 F264V probably benign Het
Trav3-1 G T 14: 52,581,050 E60D possibly damaging Het
Vmn1r237 G A 17: 21,314,354 S113N probably benign Het
Vwa8 T C 14: 79,009,170 S651P possibly damaging Het
Wnt3 G A 11: 103,808,274 V69I possibly damaging Het
Other mutations in Fbxo30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Fbxo30 APN 10 11290539 missense probably benign 0.01
IGL00971:Fbxo30 APN 10 11290298 missense probably benign
IGL02388:Fbxo30 APN 10 11290378 missense probably benign 0.01
PIT4468001:Fbxo30 UTSW 10 11290956 missense possibly damaging 0.95
R0014:Fbxo30 UTSW 10 11289859 nonsense probably null
R0144:Fbxo30 UTSW 10 11295220 missense probably damaging 1.00
R0709:Fbxo30 UTSW 10 11291313 missense possibly damaging 0.79
R1583:Fbxo30 UTSW 10 11291374 missense possibly damaging 0.67
R1791:Fbxo30 UTSW 10 11289787 nonsense probably null
R2018:Fbxo30 UTSW 10 11291028 missense probably damaging 0.98
R2317:Fbxo30 UTSW 10 11290334 missense probably damaging 0.98
R3842:Fbxo30 UTSW 10 11290112 missense probably damaging 0.98
R4579:Fbxo30 UTSW 10 11289549 missense probably benign 0.00
R4655:Fbxo30 UTSW 10 11291093 missense probably damaging 1.00
R4751:Fbxo30 UTSW 10 11290195 missense probably benign 0.01
R4998:Fbxo30 UTSW 10 11290763 missense probably damaging 0.98
R5325:Fbxo30 UTSW 10 11291102 missense possibly damaging 0.89
R5463:Fbxo30 UTSW 10 11291069 missense probably damaging 1.00
R5534:Fbxo30 UTSW 10 11289665 missense possibly damaging 0.91
R5594:Fbxo30 UTSW 10 11290479 missense probably benign 0.13
R5757:Fbxo30 UTSW 10 11290421 missense probably benign 0.08
R5917:Fbxo30 UTSW 10 11289518 critical splice acceptor site probably null
R6232:Fbxo30 UTSW 10 11289858 missense possibly damaging 0.90
R6677:Fbxo30 UTSW 10 11290636 missense possibly damaging 0.61
R6802:Fbxo30 UTSW 10 11291480 missense probably damaging 1.00
R7128:Fbxo30 UTSW 10 11290116 nonsense probably null
X0012:Fbxo30 UTSW 10 11290466 missense probably benign 0.00
X0066:Fbxo30 UTSW 10 11290812 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGCTAGGTACCAGCCTAAG -3'
(R):5'- GGGATACACATGCAAGCTGG -3'

Sequencing Primer
(F):5'- GCCTAAGCAGCGTTCAATG -3'
(R):5'- GCTGGCATAAACTGAAGCCGTC -3'
Posted On2018-05-21