Incidental Mutation 'R6470:Phlpp2'
ID516481
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene NamePH domain and leucine rich repeat protein phosphatase 2
SynonymsC130044A18Rik, Phlppl
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R6470 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location109868542-109944671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109937194 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 955 (D955G)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
Predicted Effect probably benign
Transcript: ENSMUST00000034175
AA Change: D920G

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: D920G

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149990
Predicted Effect probably benign
Transcript: ENSMUST00000179721
AA Change: D955G

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: D955G

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik G T 8: 87,564,028 V5L probably benign Het
Bptf A G 11: 107,072,767 V1804A probably damaging Het
Brinp3 A G 1: 146,901,906 D697G probably damaging Het
Carns1 T C 19: 4,171,783 T158A possibly damaging Het
Cd300lg A G 11: 102,050,505 N244S possibly damaging Het
Ces3b A T 8: 105,088,653 Q12L possibly damaging Het
Chd9 A G 8: 90,932,798 T129A probably damaging Het
Clca3a2 T A 3: 144,804,263 probably null Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyp2b10 T C 7: 25,911,656 I146T possibly damaging Het
Cyp4v3 C T 8: 45,317,736 W244* probably null Het
Dnah6 T A 6: 73,074,586 D3075V probably damaging Het
Dpy19l2 A T 9: 24,660,743 I327N possibly damaging Het
Dst T A 1: 34,295,237 F4849I probably damaging Het
Dysf A G 6: 84,066,944 I256V possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam71e2 T C 7: 4,757,851 T621A probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Gm9936 T C 5: 114,857,421 probably benign Het
Gria4 A G 9: 4,503,680 F312S probably damaging Het
Ifna2 T C 4: 88,683,514 N89S probably benign Het
Il17rb A G 14: 30,002,909 S207P probably benign Het
Itga9 A T 9: 118,897,267 I430F probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ltk A T 2: 119,753,035 probably null Het
Nat8l C T 5: 33,998,492 T164M probably damaging Het
Nrf1 A G 6: 30,102,200 D166G probably damaging Het
Nxph3 A G 11: 95,511,093 I165T possibly damaging Het
Olfr17 T C 7: 107,097,744 I93T probably damaging Het
Pianp T A 6: 124,999,269 probably benign Het
Plin2 G T 4: 86,668,370 Q75K probably damaging Het
Qrich1 T C 9: 108,534,518 V414A probably damaging Het
Ros1 A G 10: 52,166,044 probably null Het
Sardh C T 2: 27,244,372 R44Q probably damaging Het
Scaf4 C T 16: 90,229,638 W1072* probably null Het
Sh3rf3 A G 10: 58,983,969 K201E probably damaging Het
Shprh G T 10: 11,171,937 A1010S probably damaging Het
Slc35d1 A G 4: 103,189,822 S260P probably damaging Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Sptb A G 12: 76,612,829 L1099P probably damaging Het
Srrt T C 5: 137,302,656 D90G probably damaging Het
Syt10 T C 15: 89,792,601 D394G probably damaging Het
Tlr3 T C 8: 45,397,385 D301G probably damaging Het
Ubr3 T A 2: 69,965,460 M916K probably benign Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109925790 missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109937097 missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109934065 missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109939859 missense probably benign
IGL02105:Phlpp2 APN 8 109904408 missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109920099 missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109939873 missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109913618 missense probably benign
IGL03356:Phlpp2 APN 8 109935617 missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109940835 missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109939935 missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109928463 missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109895506 critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109876971 missense probably benign 0.00
R0605:Phlpp2 UTSW 8 109933211 missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109895587 missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109877030 nonsense probably null
R1417:Phlpp2 UTSW 8 109940681 nonsense probably null
R1602:Phlpp2 UTSW 8 109934023 missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 109933955 splice site probably benign
R1815:Phlpp2 UTSW 8 109940223 missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109907600 missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109940002 missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109907613 missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109876883 missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109940820 missense probably benign 0.31
R4739:Phlpp2 UTSW 8 109940420 missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 109877010 missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 109940082 missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109913619 missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109925829 missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109934035 missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109904344 missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109928573 missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109934685 missense probably benign
R6804:Phlpp2 UTSW 8 109928565 missense probably damaging 1.00
X0018:Phlpp2 UTSW 8 109912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCATAAAACTTTGCCATGTCTTC -3'
(R):5'- TGCTGATCCTGAAGCCATATG -3'

Sequencing Primer
(F):5'- TTCTACACAGGAAATTAGGAATGGC -3'
(R):5'- TGATCCTGAAGCCATATGAACTAAAC -3'
Posted On2018-05-21