Incidental Mutation 'R6470:Syt10'
ID516493
Institutional Source Beutler Lab
Gene Symbol Syt10
Ensembl Gene ENSMUSG00000063260
Gene Namesynaptotagmin X
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6470 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89782393-89841860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89792601 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 394 (D394G)
Ref Sequence ENSEMBL: ENSMUSP00000029441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029441]
Predicted Effect probably damaging
Transcript: ENSMUST00000029441
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029441
Gene: ENSMUSG00000063260
AA Change: D394G

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
C2 247 350 1.22e-19 SMART
C2 379 493 7.73e-22 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit minor circadian rhythm impairments. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik G T 8: 87,564,028 V5L probably benign Het
Bptf A G 11: 107,072,767 V1804A probably damaging Het
Brinp3 A G 1: 146,901,906 D697G probably damaging Het
Carns1 T C 19: 4,171,783 T158A possibly damaging Het
Cd300lg A G 11: 102,050,505 N244S possibly damaging Het
Ces3b A T 8: 105,088,653 Q12L possibly damaging Het
Chd9 A G 8: 90,932,798 T129A probably damaging Het
Clca3a2 T A 3: 144,804,263 probably null Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyp2b10 T C 7: 25,911,656 I146T possibly damaging Het
Cyp4v3 C T 8: 45,317,736 W244* probably null Het
Dnah6 T A 6: 73,074,586 D3075V probably damaging Het
Dpy19l2 A T 9: 24,660,743 I327N possibly damaging Het
Dst T A 1: 34,295,237 F4849I probably damaging Het
Dysf A G 6: 84,066,944 I256V possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam71e2 T C 7: 4,757,851 T621A probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Gm9936 T C 5: 114,857,421 probably benign Het
Gria4 A G 9: 4,503,680 F312S probably damaging Het
Ifna2 T C 4: 88,683,514 N89S probably benign Het
Il17rb A G 14: 30,002,909 S207P probably benign Het
Itga9 A T 9: 118,897,267 I430F probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ltk A T 2: 119,753,035 probably null Het
Nat8l C T 5: 33,998,492 T164M probably damaging Het
Nrf1 A G 6: 30,102,200 D166G probably damaging Het
Nxph3 A G 11: 95,511,093 I165T possibly damaging Het
Olfr17 T C 7: 107,097,744 I93T probably damaging Het
Phlpp2 A G 8: 109,937,194 D955G probably benign Het
Pianp T A 6: 124,999,269 probably benign Het
Plin2 G T 4: 86,668,370 Q75K probably damaging Het
Qrich1 T C 9: 108,534,518 V414A probably damaging Het
Ros1 A G 10: 52,166,044 probably null Het
Sardh C T 2: 27,244,372 R44Q probably damaging Het
Scaf4 C T 16: 90,229,638 W1072* probably null Het
Sh3rf3 A G 10: 58,983,969 K201E probably damaging Het
Shprh G T 10: 11,171,937 A1010S probably damaging Het
Slc35d1 A G 4: 103,189,822 S260P probably damaging Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Sptb A G 12: 76,612,829 L1099P probably damaging Het
Srrt T C 5: 137,302,656 D90G probably damaging Het
Tlr3 T C 8: 45,397,385 D301G probably damaging Het
Ubr3 T A 2: 69,965,460 M916K probably benign Het
Other mutations in Syt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Syt10 APN 15 89814079 missense probably damaging 1.00
IGL02976:Syt10 APN 15 89814479 missense probably benign 0.26
R0200:Syt10 UTSW 15 89826941 missense probably benign 0.01
R0306:Syt10 UTSW 15 89826988 missense probably benign 0.02
R0580:Syt10 UTSW 15 89827176 missense probably benign 0.15
R0608:Syt10 UTSW 15 89826941 missense probably benign 0.01
R1705:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1706:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1921:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R1922:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2072:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2074:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2119:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2120:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R2121:Syt10 UTSW 15 89790776 missense probably damaging 1.00
R3812:Syt10 UTSW 15 89790797 missense probably benign
R4029:Syt10 UTSW 15 89814538 missense probably benign
R4270:Syt10 UTSW 15 89790892 missense probably benign 0.39
R4536:Syt10 UTSW 15 89782622 missense probably damaging 0.99
R5333:Syt10 UTSW 15 89841729 missense probably benign 0.00
R6042:Syt10 UTSW 15 89841621 missense probably benign 0.13
R6104:Syt10 UTSW 15 89826864 missense probably benign 0.02
R6445:Syt10 UTSW 15 89814268 missense probably damaging 1.00
R6472:Syt10 UTSW 15 89814558 missense probably benign
R6679:Syt10 UTSW 15 89814371 missense probably damaging 1.00
R7048:Syt10 UTSW 15 89790805 missense probably damaging 1.00
R7128:Syt10 UTSW 15 89814111 missense not run
X0057:Syt10 UTSW 15 89826928 missense probably damaging 1.00
Z1088:Syt10 UTSW 15 89841639 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCTTTGCAAACAGACTAGC -3'
(R):5'- ATGCAAATGTTTTCACTGATCTCCC -3'

Sequencing Primer
(F):5'- GGGAACAAAGTGAATCAGGTATTTC -3'
(R):5'- AAATGTTTTCACTGATCTCCCATTTC -3'
Posted On2018-05-21