Incidental Mutation 'R6457:Nbeal1'
ID516497
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Nameneurobeachin like 1
SynonymsA530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission
Accession Numbers

Genbank: NM_173444; MGI: 2444343

Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R6457 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location60180599-60338328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60253474 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 1095 (I1095K)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834]
Predicted Effect probably benign
Transcript: ENSMUST00000160834
AA Change: I1095K

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: I1095K

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188450
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,622 V524E probably damaging Het
Acer2 T A 4: 86,900,571 M152K probably damaging Het
Actn3 T C 19: 4,871,848 D130G probably damaging Het
Ank1 T A 8: 23,087,967 F211Y probably damaging Het
Ankfn1 C T 11: 89,391,844 A326T probably benign Het
Ankrd11 G A 8: 122,908,764 R44C probably damaging Het
Ankrd46 A G 15: 36,484,071 probably benign Het
Aurkb G A 11: 69,048,346 E132K possibly damaging Het
Bsdc1 C T 4: 129,465,276 T9I possibly damaging Het
Card14 C T 11: 119,339,602 R767* probably null Het
Ccdc82 T A 9: 13,272,426 F411L possibly damaging Het
Col12a1 C T 9: 79,645,691 G2106D probably damaging Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cox10 A G 11: 63,964,372 L361P probably damaging Het
Cox18 A G 5: 90,223,689 I84T probably benign Het
Dhrs3 T C 4: 144,919,952 S125P probably damaging Het
Fbxl15 A G 19: 46,329,326 H149R probably benign Het
Flg2 T A 3: 93,220,482 S2234T unknown Het
Gtf2e1 A C 16: 37,536,336 probably null Het
H2-Q7 A T 17: 35,439,679 S98C probably damaging Het
Hcn2 G T 10: 79,733,773 E536* probably null Het
Kat6b A T 14: 21,670,680 H1700L probably damaging Het
Klhl3 C T 13: 58,100,378 V35I probably benign Het
Krt34 A T 11: 100,040,090 L162Q probably damaging Het
Ly9 A G 1: 171,589,095 S644P probably damaging Het
Magi1 A T 6: 93,699,639 V685E probably damaging Het
Malrd1 A G 2: 15,526,597 probably benign Het
Malrd1 A T 2: 15,667,929 H599L probably benign Het
Matn2 T A 15: 34,426,234 C631S probably damaging Het
Megf8 A T 7: 25,349,695 D1739V probably damaging Het
Mlf1 G A 3: 67,392,944 R98Q probably benign Het
Mprip T A 11: 59,758,989 I1173K possibly damaging Het
Mrc1 A G 2: 14,270,205 D439G probably damaging Het
Mroh5 A T 15: 73,790,842 W208R probably damaging Het
Ms4a5 T G 19: 11,279,282 I84L probably benign Het
Myt1 G A 2: 181,763,425 probably null Het
Nbea T A 3: 56,000,569 H1374L probably damaging Het
Nolc1 A G 19: 46,083,070 probably benign Het
Nr5a2 A G 1: 136,960,238 L18P probably benign Het
Nup188 G T 2: 30,322,187 C562F probably damaging Het
Obscn A G 11: 59,080,771 V2415A probably damaging Het
Pacsin2 A T 15: 83,379,678 probably null Het
Pias3 A G 3: 96,699,523 H34R possibly damaging Het
Ppfia2 T C 10: 106,893,500 V903A probably damaging Het
Pramel1 T A 4: 143,396,705 L84Q probably damaging Het
Pramel6 G A 2: 87,509,438 C182Y probably damaging Het
Prdm4 A G 10: 85,908,032 Y120H probably damaging Het
Prss28 A G 17: 25,311,357 M212V probably benign Het
Rbp3 G T 14: 33,955,267 G391* probably null Het
Rc3h2 C T 2: 37,411,139 probably null Het
Ret A G 6: 118,173,621 F645L probably benign Het
Sgsm2 A G 11: 74,865,169 S402P possibly damaging Het
Shc3 T A 13: 51,482,879 probably null Het
Slc25a16 A G 10: 62,941,159 N246S probably benign Het
Snrpd1 T A 18: 10,623,694 H26Q probably benign Het
Tex45 T C 8: 3,479,268 L251P probably damaging Het
Thsd1 A G 8: 22,243,347 T137A probably damaging Het
Tnik A T 3: 28,539,448 H151L probably damaging Het
Tns1 T A 1: 73,918,050 K1725N probably damaging Het
Tomm40l T A 1: 171,220,592 T147S probably damaging Het
Tomm6 G T 17: 47,688,007 probably benign Het
Trp53 G A 11: 69,589,614 C272Y probably damaging Het
Trpm7 A T 2: 126,807,294 V1492E probably benign Het
Tsen2 G A 6: 115,559,631 R116H probably benign Het
Uvrag A G 7: 98,906,519 F456S probably damaging Het
Vmn1r86 A T 7: 13,102,352 M199K possibly damaging Het
Vmn2r4 C T 3: 64,409,957 C120Y probably damaging Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
phainopepla UTSW 1 60319687 missense probably damaging 1.00
silky UTSW 1 60330878 splice site probably benign
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60200939 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60281895 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4119:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R4256:Nbeal1 UTSW 1 60330948 missense probably benign 0.19
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 unclassified probably null
R4798:Nbeal1 UTSW 1 60222193 unclassified probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60200951 missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7312:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAAGTTCCTAGAAAGGTTTTC -3'
(R):5'- TCTGACTCATAATGGCTCAGAAG -3'

Sequencing Primer
(F):5'- TGTCATATGCAACGACACGTGTG -3'
(R):5'- GGAAACCCTTACTCTTTATGACAGC -3'
Posted On2018-05-21