Incidental Mutation 'R6467:Cd55'
ID516617
Institutional Source Beutler Lab
Gene Symbol Cd55
Ensembl Gene ENSMUSG00000026399
Gene NameCD55 molecule, decay accelerating factor for complement
Synonymscomplement-glycosylphosphatidylinositol, Daf1, Cromer blood group, GPI-DAF, Daf-GPI
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6467 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location130439027-130462744 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 130447611 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027650]
Predicted Effect probably benign
Transcript: ENSMUST00000027650
SMART Domains Protein: ENSMUSP00000027650
Gene: ENSMUSG00000026399

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CCP 36 94 2.21e-12 SMART
CCP 98 158 3.56e-7 SMART
CCP 163 220 6.34e-13 SMART
CCP 225 284 1.28e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122830
Predicted Effect unknown
Transcript: ENSMUST00000140400
AA Change: F96L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140725
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: This gene encodes an inhibitor of both the classical and the alternative pathways of complement activation. The encoded preproprotein undergoes post-translational processing to generate a mature polypeptide anchored to the plasma membrane via a glycosylphosphatidylinositol moiety. Erythrocytes from mice deficient in the encoded protein exhibit impaired regulation of complement activation resulting in enhanced complement deposition. Mice lacking the encoded protein exhibit enhanced susceptibility to experimentally induced myasthenia gravis. This gene is located adjacent to a closely related gene on chromosome 1. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant mice show increased susceptibility to injury following ethanol exposure, to experimental autoimmune myasthenia gravis and to acute nephrotoxic nephritis. Another allele results in an abnormal complement cascade leading to increased C3 deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T C 15: 101,194,841 W122R possibly damaging Het
Adgrv1 C T 13: 81,444,538 R4294H probably benign Het
Afdn A G 17: 13,804,053 T74A probably damaging Het
Aff3 T A 1: 38,208,017 D829V probably benign Het
Akr1c12 T C 13: 4,275,773 Q107R probably benign Het
Apc T A 18: 34,269,199 F131I probably benign Het
Atp13a1 T A 8: 69,806,774 L1036H probably damaging Het
BC035044 A C 6: 128,890,892 probably benign Het
C1rl A G 6: 124,508,576 D302G probably benign Het
C2cd6 A C 1: 59,077,934 D133E probably benign Het
Cacna1c T A 6: 118,652,710 Y1061F probably damaging Het
Cav1 A G 6: 17,308,035 D62G probably damaging Het
Ccdc130 T C 8: 84,258,689 E317G probably benign Het
Ccdc77 T C 6: 120,350,281 M68V probably damaging Het
Cdc27 C A 11: 104,522,776 A380S probably damaging Het
Cenpb A T 2: 131,179,557 I107K probably damaging Het
Cep135 T G 5: 76,621,340 H612Q possibly damaging Het
Chd1l A T 3: 97,563,533 N815K probably damaging Het
Cldn20 C T 17: 3,532,717 T55M possibly damaging Het
Depdc1a A T 3: 159,516,042 I208L probably benign Het
Dgkb C T 12: 38,084,224 A43V possibly damaging Het
Dgkb C T 12: 38,604,105 T741I probably damaging Het
Dhx16 A G 17: 35,886,184 N653S probably damaging Het
Dnah5 T A 15: 28,438,183 S3987T probably benign Het
Dst T A 1: 34,295,196 I4835N probably damaging Het
Esrrb A G 12: 86,514,340 I288V probably damaging Het
Fam214b A T 4: 43,033,687 F489I probably damaging Het
Fnta C T 8: 26,007,313 W169* probably null Het
Golga4 T C 9: 118,536,792 L304P probably damaging Het
Hace1 A G 10: 45,590,266 probably null Het
Ino80b G T 6: 83,124,131 probably null Het
Kcmf1 G A 6: 72,843,099 R306C probably damaging Het
Lrrc46 G A 11: 97,036,479 T92I possibly damaging Het
Man2b1 T C 8: 85,097,447 V991A possibly damaging Het
Mga A G 2: 119,946,295 N1770S probably damaging Het
Mgat4e T C 1: 134,541,206 T367A probably benign Het
Mtr A G 13: 12,188,106 S1204P probably damaging Het
Myo15 G A 11: 60,526,661 probably null Het
Nktr T C 9: 121,731,519 S74P probably damaging Het
Noct T C 3: 51,250,087 V282A possibly damaging Het
Nol11 A T 11: 107,181,086 I227K possibly damaging Het
Nsd3 T A 8: 25,640,630 S4T probably damaging Het
Olfr1022 T A 2: 85,869,370 Y259* probably null Het
Olfr488 A G 7: 108,255,902 S79P probably damaging Het
Pds5a T A 5: 65,652,439 L393F probably damaging Het
Prex2 C T 1: 11,266,035 R1486C probably damaging Het
Rc3h2 T C 2: 37,382,016 T768A probably damaging Het
Rin3 A T 12: 102,369,325 E418D probably benign Het
Rnf214 G T 9: 45,867,588 T586N probably damaging Het
Samd4b A G 7: 28,401,860 S667P probably damaging Het
Sec14l2 T C 11: 4,111,161 Y100C probably damaging Het
Slc46a2 T C 4: 59,914,077 E282G probably benign Het
Themis A C 10: 28,781,766 N110T possibly damaging Het
Tln1 C A 4: 43,543,165 S1333I probably benign Het
Tmem53 T C 4: 117,268,428 V224A possibly damaging Het
Tmtc4 T A 14: 122,925,979 K664N possibly damaging Het
Tnni3k T C 3: 154,969,285 D201G probably damaging Het
Tnxb A G 17: 34,693,924 E1681G probably damaging Het
Trhde A T 10: 114,504,198 D567E probably damaging Het
Tsc2 T C 17: 24,609,127 M788V probably benign Het
Ube3a A G 7: 59,276,902 Y476C probably damaging Het
Ubiad1 T C 4: 148,436,225 N314S possibly damaging Het
Unc79 T A 12: 103,173,512 N2375K probably damaging Het
Vmn2r107 A T 17: 20,375,677 I831F probably damaging Het
Vwa3b T A 1: 37,085,286 C322S probably benign Het
Wdr78 T C 4: 103,049,561 D685G probably damaging Het
Wnk1 A T 6: 119,962,955 H238Q probably benign Het
Wnk2 A G 13: 49,146,605 Y210H probably damaging Het
Wwc2 T C 8: 47,851,908 D894G unknown Het
Yes1 T A 5: 32,653,037 F180Y probably damaging Het
Zbtb46 T C 2: 181,391,269 Y533C probably damaging Het
Zfp57 T C 17: 37,006,050 S7P possibly damaging Het
Zzef1 T C 11: 72,911,264 probably null Het
Other mutations in Cd55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Cd55 APN 1 130452511 nonsense probably null
IGL02207:Cd55 APN 1 130452419 missense possibly damaging 0.46
IGL02724:Cd55 APN 1 130449412 splice site probably benign
IGL02933:Cd55 APN 1 130452524 missense probably damaging 1.00
IGL02955:Cd55 APN 1 130449482 missense probably damaging 0.98
IGL03198:Cd55 APN 1 130440371 missense probably benign 0.03
PIT4618001:Cd55 UTSW 1 130456869 missense probably benign
R0055:Cd55 UTSW 1 130459576 splice site probably benign
R0411:Cd55 UTSW 1 130462557 splice site probably benign
R0426:Cd55 UTSW 1 130448372 missense probably benign 0.07
R1488:Cd55 UTSW 1 130448378 missense probably damaging 0.98
R1728:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1728:Cd55 UTSW 1 130459633 missense probably benign
R1729:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1729:Cd55 UTSW 1 130459633 missense probably benign
R1730:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1730:Cd55 UTSW 1 130459633 missense probably benign
R1739:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1739:Cd55 UTSW 1 130459633 missense probably benign
R1762:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1762:Cd55 UTSW 1 130459633 missense probably benign
R1783:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1783:Cd55 UTSW 1 130459633 missense probably benign
R1784:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1784:Cd55 UTSW 1 130459633 missense probably benign
R1785:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1785:Cd55 UTSW 1 130459633 missense probably benign
R1835:Cd55 UTSW 1 130447609 splice site probably benign
R2049:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2122:Cd55 UTSW 1 130459617 missense possibly damaging 0.94
R2141:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2142:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2935:Cd55 UTSW 1 130452426 missense possibly damaging 0.65
R4326:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R4328:Cd55 UTSW 1 130447367 intron probably benign
R4328:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R4329:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R5051:Cd55 UTSW 1 130448348 missense probably damaging 0.99
R7219:Cd55 UTSW 1 130462606 missense possibly damaging 0.73
Z1088:Cd55 UTSW 1 130452479 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGTGTCCACAAAACAAGCG -3'
(R):5'- CTATCCTGCAGAACTTATTAGTGC -3'

Sequencing Primer
(F):5'- CAAGCGGATTAAAGGGATTTACC -3'
(R):5'- AGAACTTATTAGTGCTTATGTTGCTG -3'
Posted On2018-05-21