Incidental Mutation 'R6467:Tln1'
ID516629
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6467 (G1)
Quality Score185.009
Status Validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43543165 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 1333 (S1333I)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
PDB Structure
Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000030187
AA Change: S1333I

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: S1333I

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T C 15: 101,194,841 W122R possibly damaging Het
Adgrv1 C T 13: 81,444,538 R4294H probably benign Het
Afdn A G 17: 13,804,053 T74A probably damaging Het
Aff3 T A 1: 38,208,017 D829V probably benign Het
Akr1c12 T C 13: 4,275,773 Q107R probably benign Het
Apc T A 18: 34,269,199 F131I probably benign Het
Atp13a1 T A 8: 69,806,774 L1036H probably damaging Het
BC035044 A C 6: 128,890,892 probably benign Het
C1rl A G 6: 124,508,576 D302G probably benign Het
C2cd6 A C 1: 59,077,934 D133E probably benign Het
Cacna1c T A 6: 118,652,710 Y1061F probably damaging Het
Cav1 A G 6: 17,308,035 D62G probably damaging Het
Ccdc130 T C 8: 84,258,689 E317G probably benign Het
Ccdc77 T C 6: 120,350,281 M68V probably damaging Het
Cd55 A T 1: 130,447,611 probably benign Het
Cdc27 C A 11: 104,522,776 A380S probably damaging Het
Cenpb A T 2: 131,179,557 I107K probably damaging Het
Cep135 T G 5: 76,621,340 H612Q possibly damaging Het
Chd1l A T 3: 97,563,533 N815K probably damaging Het
Cldn20 C T 17: 3,532,717 T55M possibly damaging Het
Depdc1a A T 3: 159,516,042 I208L probably benign Het
Dgkb C T 12: 38,084,224 A43V possibly damaging Het
Dgkb C T 12: 38,604,105 T741I probably damaging Het
Dhx16 A G 17: 35,886,184 N653S probably damaging Het
Dnah5 T A 15: 28,438,183 S3987T probably benign Het
Dst T A 1: 34,295,196 I4835N probably damaging Het
Esrrb A G 12: 86,514,340 I288V probably damaging Het
Fam214b A T 4: 43,033,687 F489I probably damaging Het
Fnta C T 8: 26,007,313 W169* probably null Het
Golga4 T C 9: 118,536,792 L304P probably damaging Het
Hace1 A G 10: 45,590,266 probably null Het
Ino80b G T 6: 83,124,131 probably null Het
Kcmf1 G A 6: 72,843,099 R306C probably damaging Het
Lrrc46 G A 11: 97,036,479 T92I possibly damaging Het
Man2b1 T C 8: 85,097,447 V991A possibly damaging Het
Mga A G 2: 119,946,295 N1770S probably damaging Het
Mgat4e T C 1: 134,541,206 T367A probably benign Het
Mtr A G 13: 12,188,106 S1204P probably damaging Het
Myo15 G A 11: 60,526,661 probably null Het
Nktr T C 9: 121,731,519 S74P probably damaging Het
Noct T C 3: 51,250,087 V282A possibly damaging Het
Nol11 A T 11: 107,181,086 I227K possibly damaging Het
Nsd3 T A 8: 25,640,630 S4T probably damaging Het
Olfr1022 T A 2: 85,869,370 Y259* probably null Het
Olfr488 A G 7: 108,255,902 S79P probably damaging Het
Pds5a T A 5: 65,652,439 L393F probably damaging Het
Prex2 C T 1: 11,266,035 R1486C probably damaging Het
Rc3h2 T C 2: 37,382,016 T768A probably damaging Het
Rin3 A T 12: 102,369,325 E418D probably benign Het
Rnf214 G T 9: 45,867,588 T586N probably damaging Het
Samd4b A G 7: 28,401,860 S667P probably damaging Het
Sec14l2 T C 11: 4,111,161 Y100C probably damaging Het
Slc46a2 T C 4: 59,914,077 E282G probably benign Het
Themis A C 10: 28,781,766 N110T possibly damaging Het
Tmem53 T C 4: 117,268,428 V224A possibly damaging Het
Tmtc4 T A 14: 122,925,979 K664N possibly damaging Het
Tnni3k T C 3: 154,969,285 D201G probably damaging Het
Tnxb A G 17: 34,693,924 E1681G probably damaging Het
Trhde A T 10: 114,504,198 D567E probably damaging Het
Tsc2 T C 17: 24,609,127 M788V probably benign Het
Ube3a A G 7: 59,276,902 Y476C probably damaging Het
Ubiad1 T C 4: 148,436,225 N314S possibly damaging Het
Unc79 T A 12: 103,173,512 N2375K probably damaging Het
Vmn2r107 A T 17: 20,375,677 I831F probably damaging Het
Vwa3b T A 1: 37,085,286 C322S probably benign Het
Wdr78 T C 4: 103,049,561 D685G probably damaging Het
Wnk1 A T 6: 119,962,955 H238Q probably benign Het
Wnk2 A G 13: 49,146,605 Y210H probably damaging Het
Wwc2 T C 8: 47,851,908 D894G unknown Het
Yes1 T A 5: 32,653,037 F180Y probably damaging Het
Zbtb46 T C 2: 181,391,269 Y533C probably damaging Het
Zfp57 T C 17: 37,006,050 S7P possibly damaging Het
Zzef1 T C 11: 72,911,264 probably null Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 unclassified probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGATGCTGTCCGTCACTG -3'
(R):5'- ATACTTGGGAAAGGGCGTCC -3'

Sequencing Primer
(F):5'- GTCCGTCACTGCCCTGATG -3'
(R):5'- CGTCCTTTTAGAGACAGGCATGAC -3'
Posted On2018-05-21