Incidental Mutation 'R6467:Cep135'
ID516636
Institutional Source Beutler Lab
Gene Symbol Cep135
Ensembl Gene ENSMUSG00000036403
Gene Namecentrosomal protein 135
SynonymsLOC381644, Cep4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6467 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location76588698-76646466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 76621340 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 612 (H612Q)
Ref Sequence ENSEMBL: ENSMUSP00000112602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049060
AA Change: H612Q

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: H612Q

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121979
AA Change: H612Q

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: H612Q

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130651
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T C 15: 101,194,841 W122R possibly damaging Het
Adgrv1 C T 13: 81,444,538 R4294H probably benign Het
Afdn A G 17: 13,804,053 T74A probably damaging Het
Aff3 T A 1: 38,208,017 D829V probably benign Het
Akr1c12 T C 13: 4,275,773 Q107R probably benign Het
Apc T A 18: 34,269,199 F131I probably benign Het
Atp13a1 T A 8: 69,806,774 L1036H probably damaging Het
BC035044 A C 6: 128,890,892 probably benign Het
C1rl A G 6: 124,508,576 D302G probably benign Het
C2cd6 A C 1: 59,077,934 D133E probably benign Het
Cacna1c T A 6: 118,652,710 Y1061F probably damaging Het
Cav1 A G 6: 17,308,035 D62G probably damaging Het
Ccdc130 T C 8: 84,258,689 E317G probably benign Het
Ccdc77 T C 6: 120,350,281 M68V probably damaging Het
Cd55 A T 1: 130,447,611 probably benign Het
Cdc27 C A 11: 104,522,776 A380S probably damaging Het
Cenpb A T 2: 131,179,557 I107K probably damaging Het
Chd1l A T 3: 97,563,533 N815K probably damaging Het
Cldn20 C T 17: 3,532,717 T55M possibly damaging Het
Depdc1a A T 3: 159,516,042 I208L probably benign Het
Dgkb C T 12: 38,084,224 A43V possibly damaging Het
Dgkb C T 12: 38,604,105 T741I probably damaging Het
Dhx16 A G 17: 35,886,184 N653S probably damaging Het
Dnah5 T A 15: 28,438,183 S3987T probably benign Het
Dst T A 1: 34,295,196 I4835N probably damaging Het
Esrrb A G 12: 86,514,340 I288V probably damaging Het
Fam214b A T 4: 43,033,687 F489I probably damaging Het
Fnta C T 8: 26,007,313 W169* probably null Het
Golga4 T C 9: 118,536,792 L304P probably damaging Het
Hace1 A G 10: 45,590,266 probably null Het
Ino80b G T 6: 83,124,131 probably null Het
Kcmf1 G A 6: 72,843,099 R306C probably damaging Het
Lrrc46 G A 11: 97,036,479 T92I possibly damaging Het
Man2b1 T C 8: 85,097,447 V991A possibly damaging Het
Mga A G 2: 119,946,295 N1770S probably damaging Het
Mgat4e T C 1: 134,541,206 T367A probably benign Het
Mtr A G 13: 12,188,106 S1204P probably damaging Het
Myo15 G A 11: 60,526,661 probably null Het
Nktr T C 9: 121,731,519 S74P probably damaging Het
Noct T C 3: 51,250,087 V282A possibly damaging Het
Nol11 A T 11: 107,181,086 I227K possibly damaging Het
Nsd3 T A 8: 25,640,630 S4T probably damaging Het
Olfr1022 T A 2: 85,869,370 Y259* probably null Het
Olfr488 A G 7: 108,255,902 S79P probably damaging Het
Pds5a T A 5: 65,652,439 L393F probably damaging Het
Prex2 C T 1: 11,266,035 R1486C probably damaging Het
Rc3h2 T C 2: 37,382,016 T768A probably damaging Het
Rin3 A T 12: 102,369,325 E418D probably benign Het
Rnf214 G T 9: 45,867,588 T586N probably damaging Het
Samd4b A G 7: 28,401,860 S667P probably damaging Het
Sec14l2 T C 11: 4,111,161 Y100C probably damaging Het
Slc46a2 T C 4: 59,914,077 E282G probably benign Het
Themis A C 10: 28,781,766 N110T possibly damaging Het
Tln1 C A 4: 43,543,165 S1333I probably benign Het
Tmem53 T C 4: 117,268,428 V224A possibly damaging Het
Tmtc4 T A 14: 122,925,979 K664N possibly damaging Het
Tnni3k T C 3: 154,969,285 D201G probably damaging Het
Tnxb A G 17: 34,693,924 E1681G probably damaging Het
Trhde A T 10: 114,504,198 D567E probably damaging Het
Tsc2 T C 17: 24,609,127 M788V probably benign Het
Ube3a A G 7: 59,276,902 Y476C probably damaging Het
Ubiad1 T C 4: 148,436,225 N314S possibly damaging Het
Unc79 T A 12: 103,173,512 N2375K probably damaging Het
Vmn2r107 A T 17: 20,375,677 I831F probably damaging Het
Vwa3b T A 1: 37,085,286 C322S probably benign Het
Wdr78 T C 4: 103,049,561 D685G probably damaging Het
Wnk1 A T 6: 119,962,955 H238Q probably benign Het
Wnk2 A G 13: 49,146,605 Y210H probably damaging Het
Wwc2 T C 8: 47,851,908 D894G unknown Het
Yes1 T A 5: 32,653,037 F180Y probably damaging Het
Zbtb46 T C 2: 181,391,269 Y533C probably damaging Het
Zfp57 T C 17: 37,006,050 S7P possibly damaging Het
Zzef1 T C 11: 72,911,264 probably null Het
Other mutations in Cep135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep135 APN 5 76601459 missense probably damaging 0.98
IGL01154:Cep135 APN 5 76606796 splice site probably benign
IGL01323:Cep135 APN 5 76591765 missense probably benign 0.29
IGL01599:Cep135 APN 5 76593347 missense possibly damaging 0.93
IGL01923:Cep135 APN 5 76640982 makesense probably null
IGL02178:Cep135 APN 5 76595474 missense probably damaging 1.00
IGL02276:Cep135 APN 5 76634246 missense probably benign 0.00
IGL02344:Cep135 APN 5 76616821 missense probably benign
IGL02394:Cep135 APN 5 76631471 missense probably benign 0.02
IGL02740:Cep135 APN 5 76638268 critical splice donor site probably null
IGL02832:Cep135 APN 5 76640949 missense probably damaging 0.98
R0026:Cep135 UTSW 5 76606734 nonsense probably null
R0060:Cep135 UTSW 5 76621350 missense probably benign 0.20
R0325:Cep135 UTSW 5 76615743 missense probably damaging 0.98
R0336:Cep135 UTSW 5 76601502 missense probably benign 0.07
R0564:Cep135 UTSW 5 76615710 missense probably damaging 1.00
R0564:Cep135 UTSW 5 76638949 missense probably benign 0.03
R0600:Cep135 UTSW 5 76621305 missense probably benign
R0636:Cep135 UTSW 5 76615657 missense probably benign 0.07
R0704:Cep135 UTSW 5 76630949 missense possibly damaging 0.62
R0835:Cep135 UTSW 5 76615706 missense probably benign 0.40
R1015:Cep135 UTSW 5 76640997 critical splice donor site probably null
R1167:Cep135 UTSW 5 76624637 missense probably damaging 1.00
R1252:Cep135 UTSW 5 76594115 missense possibly damaging 0.67
R1554:Cep135 UTSW 5 76634213 nonsense probably null
R1770:Cep135 UTSW 5 76603195 missense possibly damaging 0.95
R1804:Cep135 UTSW 5 76636932 missense probably benign 0.22
R1968:Cep135 UTSW 5 76624747 missense possibly damaging 0.96
R1987:Cep135 UTSW 5 76597428 missense probably benign 0.00
R1996:Cep135 UTSW 5 76632266 missense probably benign 0.08
R2004:Cep135 UTSW 5 76632329 critical splice donor site probably null
R2178:Cep135 UTSW 5 76631450 missense probably benign 0.00
R2305:Cep135 UTSW 5 76595389 splice site probably benign
R2679:Cep135 UTSW 5 76624660 missense probably benign
R3125:Cep135 UTSW 5 76621363 critical splice donor site probably null
R3623:Cep135 UTSW 5 76624739 missense probably benign 0.00
R4359:Cep135 UTSW 5 76611714 missense possibly damaging 0.47
R4407:Cep135 UTSW 5 76624667 missense probably benign
R4561:Cep135 UTSW 5 76638193 missense possibly damaging 0.95
R4666:Cep135 UTSW 5 76616854 missense probably benign
R4945:Cep135 UTSW 5 76597428 missense probably benign 0.00
R5105:Cep135 UTSW 5 76594092 missense probably benign 0.00
R5117:Cep135 UTSW 5 76631429 missense probably benign 0.01
R5176:Cep135 UTSW 5 76637026 missense probably benign 0.04
R5194:Cep135 UTSW 5 76615777 missense probably benign 0.05
R5233:Cep135 UTSW 5 76591843 small deletion probably benign
R5275:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5295:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5412:Cep135 UTSW 5 76616862 missense probably benign 0.00
R5427:Cep135 UTSW 5 76638202 missense probably benign 0.00
R5801:Cep135 UTSW 5 76630676 missense probably damaging 1.00
R5975:Cep135 UTSW 5 76640890 missense possibly damaging 0.94
R6087:Cep135 UTSW 5 76615791 critical splice donor site probably null
R6176:Cep135 UTSW 5 76624643 missense probably benign
R6210:Cep135 UTSW 5 76624723 missense probably benign 0.15
R6456:Cep135 UTSW 5 76591724 start gained probably benign
R6622:Cep135 UTSW 5 76640968 missense probably benign 0.00
R6650:Cep135 UTSW 5 76633701 missense possibly damaging 0.77
R6838:Cep135 UTSW 5 76632215 missense probably damaging 1.00
R7028:Cep135 UTSW 5 76616848 missense probably benign
R7049:Cep135 UTSW 5 76606738 missense probably benign 0.01
R7095:Cep135 UTSW 5 76594058 missense probably benign 0.10
R7207:Cep135 UTSW 5 76632243 missense probably benign 0.00
R7330:Cep135 UTSW 5 76606745 nonsense probably null
R7369:Cep135 UTSW 5 76593253 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCATGACACACAAAGATAGGC -3'
(R):5'- ATAAGAGCCGAGAACCTGGC -3'

Sequencing Primer
(F):5'- TGACACACAAAGATAGGCAATAAAAC -3'
(R):5'- CCGAGAACCTGGCCTAGC -3'
Posted On2018-05-21