Incidental Mutation 'R6467:Myo15'
ID516660
Institutional Source Beutler Lab
Gene Symbol Myo15
Ensembl Gene ENSMUSG00000042678
Gene Namemyosin XV
Synonymssh2; sh-2; Myo15a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6467 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location60469339-60528369 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 60526661 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
Predicted Effect probably null
Transcript: ENSMUST00000071880
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081823
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000094135
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122825
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T C 15: 101,194,841 W122R possibly damaging Het
Adgrv1 C T 13: 81,444,538 R4294H probably benign Het
Afdn A G 17: 13,804,053 T74A probably damaging Het
Aff3 T A 1: 38,208,017 D829V probably benign Het
Akr1c12 T C 13: 4,275,773 Q107R probably benign Het
Apc T A 18: 34,269,199 F131I probably benign Het
Atp13a1 T A 8: 69,806,774 L1036H probably damaging Het
BC035044 A C 6: 128,890,892 probably benign Het
C1rl A G 6: 124,508,576 D302G probably benign Het
C2cd6 A C 1: 59,077,934 D133E probably benign Het
Cacna1c T A 6: 118,652,710 Y1061F probably damaging Het
Cav1 A G 6: 17,308,035 D62G probably damaging Het
Ccdc130 T C 8: 84,258,689 E317G probably benign Het
Ccdc77 T C 6: 120,350,281 M68V probably damaging Het
Cd55 A T 1: 130,447,611 probably benign Het
Cdc27 C A 11: 104,522,776 A380S probably damaging Het
Cenpb A T 2: 131,179,557 I107K probably damaging Het
Cep135 T G 5: 76,621,340 H612Q possibly damaging Het
Chd1l A T 3: 97,563,533 N815K probably damaging Het
Cldn20 C T 17: 3,532,717 T55M possibly damaging Het
Depdc1a A T 3: 159,516,042 I208L probably benign Het
Dgkb C T 12: 38,084,224 A43V possibly damaging Het
Dgkb C T 12: 38,604,105 T741I probably damaging Het
Dhx16 A G 17: 35,886,184 N653S probably damaging Het
Dnah5 T A 15: 28,438,183 S3987T probably benign Het
Dst T A 1: 34,295,196 I4835N probably damaging Het
Esrrb A G 12: 86,514,340 I288V probably damaging Het
Fam214b A T 4: 43,033,687 F489I probably damaging Het
Fnta C T 8: 26,007,313 W169* probably null Het
Golga4 T C 9: 118,536,792 L304P probably damaging Het
Hace1 A G 10: 45,590,266 probably null Het
Ino80b G T 6: 83,124,131 probably null Het
Kcmf1 G A 6: 72,843,099 R306C probably damaging Het
Lrrc46 G A 11: 97,036,479 T92I possibly damaging Het
Man2b1 T C 8: 85,097,447 V991A possibly damaging Het
Mga A G 2: 119,946,295 N1770S probably damaging Het
Mgat4e T C 1: 134,541,206 T367A probably benign Het
Mtr A G 13: 12,188,106 S1204P probably damaging Het
Nktr T C 9: 121,731,519 S74P probably damaging Het
Noct T C 3: 51,250,087 V282A possibly damaging Het
Nol11 A T 11: 107,181,086 I227K possibly damaging Het
Nsd3 T A 8: 25,640,630 S4T probably damaging Het
Olfr1022 T A 2: 85,869,370 Y259* probably null Het
Olfr488 A G 7: 108,255,902 S79P probably damaging Het
Pds5a T A 5: 65,652,439 L393F probably damaging Het
Prex2 C T 1: 11,266,035 R1486C probably damaging Het
Rc3h2 T C 2: 37,382,016 T768A probably damaging Het
Rin3 A T 12: 102,369,325 E418D probably benign Het
Rnf214 G T 9: 45,867,588 T586N probably damaging Het
Samd4b A G 7: 28,401,860 S667P probably damaging Het
Sec14l2 T C 11: 4,111,161 Y100C probably damaging Het
Slc46a2 T C 4: 59,914,077 E282G probably benign Het
Themis A C 10: 28,781,766 N110T possibly damaging Het
Tln1 C A 4: 43,543,165 S1333I probably benign Het
Tmem53 T C 4: 117,268,428 V224A possibly damaging Het
Tmtc4 T A 14: 122,925,979 K664N possibly damaging Het
Tnni3k T C 3: 154,969,285 D201G probably damaging Het
Tnxb A G 17: 34,693,924 E1681G probably damaging Het
Trhde A T 10: 114,504,198 D567E probably damaging Het
Tsc2 T C 17: 24,609,127 M788V probably benign Het
Ube3a A G 7: 59,276,902 Y476C probably damaging Het
Ubiad1 T C 4: 148,436,225 N314S possibly damaging Het
Unc79 T A 12: 103,173,512 N2375K probably damaging Het
Vmn2r107 A T 17: 20,375,677 I831F probably damaging Het
Vwa3b T A 1: 37,085,286 C322S probably benign Het
Wdr78 T C 4: 103,049,561 D685G probably damaging Het
Wnk1 A T 6: 119,962,955 H238Q probably benign Het
Wnk2 A G 13: 49,146,605 Y210H probably damaging Het
Wwc2 T C 8: 47,851,908 D894G unknown Het
Yes1 T A 5: 32,653,037 F180Y probably damaging Het
Zbtb46 T C 2: 181,391,269 Y533C probably damaging Het
Zfp57 T C 17: 37,006,050 S7P possibly damaging Het
Zzef1 T C 11: 72,911,264 probably null Het
Other mutations in Myo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Myo15 APN 11 60477779 missense probably damaging 1.00
IGL01011:Myo15 APN 11 60476992 missense probably benign 0.33
IGL01100:Myo15 APN 11 60511158 missense probably damaging 1.00
IGL01357:Myo15 APN 11 60502289 splice site probably benign
IGL01634:Myo15 APN 11 60495472 missense probably damaging 1.00
IGL01763:Myo15 APN 11 60521738 missense probably benign 0.07
IGL01901:Myo15 APN 11 60527434 utr 3 prime probably benign
IGL01931:Myo15 APN 11 60496138 missense probably damaging 1.00
IGL02006:Myo15 APN 11 60511128 missense probably damaging 1.00
IGL02041:Myo15 APN 11 60506863 missense probably damaging 0.99
IGL02094:Myo15 APN 11 60510647 unclassified probably benign
IGL02122:Myo15 APN 11 60483466 missense probably benign 0.23
IGL02153:Myo15 APN 11 60498397 missense probably damaging 1.00
IGL02328:Myo15 APN 11 60526607 missense probably benign 0.13
IGL02330:Myo15 APN 11 60477161 missense possibly damaging 0.94
IGL02431:Myo15 APN 11 60510639 missense possibly damaging 0.73
IGL02639:Myo15 APN 11 60478621 missense probably benign
IGL02659:Myo15 APN 11 60491783 splice site probably benign
IGL02800:Myo15 APN 11 60502369 missense probably damaging 1.00
IGL02812:Myo15 APN 11 60477179 missense probably benign 0.15
IGL02863:Myo15 APN 11 60478127 missense probably damaging 1.00
IGL02873:Myo15 APN 11 60483482 missense probably damaging 1.00
IGL02990:Myo15 APN 11 60479440 missense probably benign 0.02
IGL03011:Myo15 APN 11 60509531 splice site probably benign
IGL03243:Myo15 APN 11 60496518 missense probably damaging 1.00
IGL03297:Myo15 APN 11 60479141 missense probably damaging 1.00
parker UTSW 11 60520914 critical splice donor site probably null
typhoon UTSW 11 60487425 critical splice donor site probably null
PIT4131001:Myo15 UTSW 11 60483127 missense probably damaging 1.00
PIT4131001:Myo15 UTSW 11 60495454 missense probably damaging 1.00
R0133:Myo15 UTSW 11 60477850 missense possibly damaging 0.94
R0265:Myo15 UTSW 11 60514897 critical splice acceptor site probably null
R0389:Myo15 UTSW 11 60478538 missense probably benign
R0416:Myo15 UTSW 11 60511174 missense probably damaging 1.00
R0449:Myo15 UTSW 11 60509596 missense possibly damaging 0.92
R0477:Myo15 UTSW 11 60520914 critical splice donor site probably null
R0543:Myo15 UTSW 11 60479051 missense probably benign
R0546:Myo15 UTSW 11 60506313 missense probably damaging 1.00
R0555:Myo15 UTSW 11 60521638 missense probably damaging 1.00
R0639:Myo15 UTSW 11 60479336 missense probably benign 0.12
R0723:Myo15 UTSW 11 60478977 missense possibly damaging 0.94
R0837:Myo15 UTSW 11 60487251 missense probably damaging 0.98
R0865:Myo15 UTSW 11 60491688 missense probably damaging 1.00
R0899:Myo15 UTSW 11 60477185 missense possibly damaging 0.87
R1022:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1024:Myo15 UTSW 11 60479616 missense probably benign 0.00
R1035:Myo15 UTSW 11 60510558 unclassified probably benign
R1109:Myo15 UTSW 11 60493066 missense probably damaging 1.00
R1170:Myo15 UTSW 11 60479407 missense probably benign 0.04
R1241:Myo15 UTSW 11 60499430 missense possibly damaging 0.58
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1392:Myo15 UTSW 11 60477974 missense possibly damaging 0.95
R1434:Myo15 UTSW 11 60504331 missense probably benign 0.00
R1450:Myo15 UTSW 11 60495482 missense probably damaging 1.00
R1456:Myo15 UTSW 11 60508202 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1468:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R1548:Myo15 UTSW 11 60488238 missense probably damaging 1.00
R1551:Myo15 UTSW 11 60492965 missense possibly damaging 0.70
R1571:Myo15 UTSW 11 60518464 missense probably damaging 1.00
R1662:Myo15 UTSW 11 60501701 missense probably damaging 1.00
R1777:Myo15 UTSW 11 60514936 missense probably benign
R1778:Myo15 UTSW 11 60478412 missense possibly damaging 0.57
R1847:Myo15 UTSW 11 60499495 nonsense probably null
R1875:Myo15 UTSW 11 60507528 missense probably damaging 0.99
R1944:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R1945:Myo15 UTSW 11 60502083 missense probably damaging 0.99
R2013:Myo15 UTSW 11 60494231 missense probably damaging 1.00
R2107:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2108:Myo15 UTSW 11 60491810 missense probably damaging 1.00
R2112:Myo15 UTSW 11 60494168 missense probably damaging 0.99
R2147:Myo15 UTSW 11 60510229 missense possibly damaging 0.66
R2196:Myo15 UTSW 11 60510021 nonsense probably null
R2207:Myo15 UTSW 11 60506034 missense probably benign 0.01
R2245:Myo15 UTSW 11 60509099 missense probably damaging 1.00
R2367:Myo15 UTSW 11 60517238 missense probably damaging 0.99
R2374:Myo15 UTSW 11 60478843 missense possibly damaging 0.88
R2438:Myo15 UTSW 11 60483052 missense probably damaging 1.00
R3154:Myo15 UTSW 11 60479360 unclassified probably null
R3423:Myo15 UTSW 11 60510300 critical splice donor site probably null
R3551:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3552:Myo15 UTSW 11 60509663 missense possibly damaging 0.93
R3612:Myo15 UTSW 11 60477679 missense probably damaging 1.00
R3620:Myo15 UTSW 11 60478642 missense possibly damaging 0.63
R3713:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3714:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3715:Myo15 UTSW 11 60479231 missense possibly damaging 0.55
R3783:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3784:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3785:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3786:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3787:Myo15 UTSW 11 60477572 missense probably damaging 0.97
R3894:Myo15 UTSW 11 60504319 missense probably benign 0.00
R3962:Myo15 UTSW 11 60479828 missense probably benign 0.00
R4082:Myo15 UTSW 11 60487196 missense possibly damaging 0.92
R4555:Myo15 UTSW 11 60496937 missense probably damaging 1.00
R4641:Myo15 UTSW 11 60503041 missense probably damaging 1.00
R4665:Myo15 UTSW 11 60504879 critical splice acceptor site probably null
R4713:Myo15 UTSW 11 60479930 missense probably benign 0.21
R4820:Myo15 UTSW 11 60476915 missense probably damaging 0.98
R5013:Myo15 UTSW 11 60491667 missense probably damaging 1.00
R5051:Myo15 UTSW 11 60487425 critical splice donor site probably null
R5187:Myo15 UTSW 11 60503614 missense probably damaging 1.00
R5230:Myo15 UTSW 11 60502848 missense possibly damaging 0.68
R5277:Myo15 UTSW 11 60477114 nonsense probably null
R5345:Myo15 UTSW 11 60497538 missense probably damaging 0.99
R5349:Myo15 UTSW 11 60493583 missense probably damaging 1.00
R5356:Myo15 UTSW 11 60498366 missense probably damaging 1.00
R5445:Myo15 UTSW 11 60520777 nonsense probably null
R5477:Myo15 UTSW 11 60477677 missense probably damaging 1.00
R5629:Myo15 UTSW 11 60479752 missense probably benign
R5728:Myo15 UTSW 11 60488896 missense probably damaging 1.00
R5818:Myo15 UTSW 11 60497951 missense probably benign 0.06
R5952:Myo15 UTSW 11 60479420 missense possibly damaging 0.50
R6338:Myo15 UTSW 11 60478133 missense probably damaging 0.99
R6488:Myo15 UTSW 11 60478487 missense possibly damaging 0.86
R6521:Myo15 UTSW 11 60502369 missense probably damaging 1.00
R6645:Myo15 UTSW 11 60477292 missense probably benign 0.00
R6702:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6703:Myo15 UTSW 11 60492992 missense probably benign 0.16
R6821:Myo15 UTSW 11 60524475 missense probably damaging 1.00
R6882:Myo15 UTSW 11 60524006 missense probably damaging 1.00
R6908:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R6932:Myo15 UTSW 11 60499494 missense probably damaging 1.00
R6958:Myo15 UTSW 11 60503625 missense probably benign 0.07
R7041:Myo15 UTSW 11 60506006 missense probably damaging 1.00
R7149:Myo15 UTSW 11 60510010 missense possibly damaging 0.56
R7163:Myo15 UTSW 11 60498369 missense
R7229:Myo15 UTSW 11 60496495 missense probably benign 0.08
R7347:Myo15 UTSW 11 60477961 missense probably benign
R7392:Myo15 UTSW 11 60505976 missense
R7414:Myo15 UTSW 11 60483483 missense
R7461:Myo15 UTSW 11 60505152 missense
X0021:Myo15 UTSW 11 60482359 nonsense probably null
X0066:Myo15 UTSW 11 60478220 missense probably damaging 1.00
X0067:Myo15 UTSW 11 60478618 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCACGAAGCATCAGTATTTGTTG -3'
(R):5'- TGCTAAACTGCTTCCTGGG -3'

Sequencing Primer
(F):5'- AACTGACATAGAGCTGGGCCTTC -3'
(R):5'- GGGAAGGCCTTCACAATAGCTC -3'
Posted On2018-05-21