Incidental Mutation 'R6471:Cobll1'
ID516687
Institutional Source Beutler Lab
Gene Symbol Cobll1
Ensembl Gene ENSMUSG00000034903
Gene NameCobl-like 1
SynonymsD430044D16Rik, Coblr1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R6471 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location65088339-65239403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65107884 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 352 (S352P)
Ref Sequence ENSEMBL: ENSMUSP00000088412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090896] [ENSMUST00000102726] [ENSMUST00000112429] [ENSMUST00000112430] [ENSMUST00000112431]
Predicted Effect probably damaging
Transcript: ENSMUST00000090896
AA Change: S352P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088412
Gene: ENSMUSG00000034903
AA Change: S352P

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 1.3e-38 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 1023 1034 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102726
AA Change: S352P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099787
Gene: ENSMUSG00000034903
AA Change: S352P

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1060 1071 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112429
AA Change: S352P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108048
Gene: ENSMUSG00000034903
AA Change: S352P

DomainStartEndE-ValueType
Pfam:Cobl 148 239 5.4e-49 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112430
AA Change: S351P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108049
Gene: ENSMUSG00000034903
AA Change: S351P

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
Pfam:Cobl 185 263 1.3e-38 PFAM
low complexity region 331 342 N/A INTRINSIC
low complexity region 425 437 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112431
AA Change: S352P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108050
Gene: ENSMUSG00000034903
AA Change: S352P

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155768
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.6%
Validation Efficiency 97% (29/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Birc3 A G 9: 7,857,420 S351P probably benign Het
Car9 T C 4: 43,511,938 V319A probably damaging Het
Ccdc86 A G 19: 10,948,879 S119P unknown Het
Cideb T C 14: 55,757,952 R26G probably benign Het
Clip1 A G 5: 123,640,549 V437A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Exoc3l A G 8: 105,290,534 V607A probably damaging Het
Fam227b A T 2: 126,121,065 V177D probably damaging Het
Fam96a T A 9: 66,126,857 V4E possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gdap1 T A 1: 17,160,025 N227K possibly damaging Het
Glod4 A T 11: 76,233,918 F185L probably damaging Het
Gm884 T A 11: 103,619,622 probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map3k19 C T 1: 127,817,254 V1488M probably damaging Het
Pak7 A T 2: 136,116,190 M326K probably benign Het
Peak1 A G 9: 56,258,259 L795P probably damaging Het
Plcg1 A G 2: 160,753,710 D526G probably benign Het
Rapgef6 A G 11: 54,691,737 I1492V probably damaging Het
Rbfa G T 18: 80,200,458 S31* probably null Het
Rnft1 T C 11: 86,491,682 Y244H possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Slc6a3 G A 13: 73,544,884 G208R probably benign Het
Tex15 G T 8: 33,581,734 Q2436H probably damaging Het
Ttbk1 A G 17: 46,467,277 L613P probably benign Het
Tuba1b T C 15: 98,932,447 K164R probably benign Het
Usp9y A G Y: 1,384,511 L669P probably damaging Homo
Vmn1r169 A G 7: 23,577,545 T121A probably benign Het
Vmn2r51 A C 7: 10,102,583 D90E possibly damaging Het
Zfp318 A G 17: 46,399,505 H718R probably benign Het
Zfp93 T C 7: 24,273,329 Y33H probably damaging Het
Other mutations in Cobll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cobll1 APN 2 65126013 missense probably damaging 1.00
IGL01074:Cobll1 APN 2 65107848 missense probably damaging 1.00
IGL01093:Cobll1 APN 2 65098237 missense probably damaging 1.00
IGL02411:Cobll1 APN 2 65097740 missense probably damaging 1.00
IGL02419:Cobll1 APN 2 65151048 missense probably damaging 1.00
IGL02550:Cobll1 APN 2 65107863 missense probably damaging 1.00
IGL02607:Cobll1 APN 2 65151085 missense probably damaging 0.98
IGL02829:Cobll1 APN 2 65126045 missense probably damaging 1.00
IGL02802:Cobll1 UTSW 2 65098319 missense probably damaging 0.99
R0313:Cobll1 UTSW 2 65095744 nonsense probably null
R0314:Cobll1 UTSW 2 65089521 missense possibly damaging 0.81
R0322:Cobll1 UTSW 2 65102098 missense possibly damaging 0.84
R0846:Cobll1 UTSW 2 65102065 splice site probably null
R1163:Cobll1 UTSW 2 65098279 missense probably damaging 0.96
R1242:Cobll1 UTSW 2 65151169 critical splice acceptor site probably null
R1364:Cobll1 UTSW 2 65126310 splice site probably benign
R1445:Cobll1 UTSW 2 65099136 missense probably damaging 1.00
R1610:Cobll1 UTSW 2 65133642 missense probably damaging 1.00
R1836:Cobll1 UTSW 2 65126236 missense probably damaging 1.00
R2102:Cobll1 UTSW 2 65098210 missense probably damaging 1.00
R3154:Cobll1 UTSW 2 65107050 missense probably benign 0.00
R4580:Cobll1 UTSW 2 65151073 missense probably benign 0.00
R4638:Cobll1 UTSW 2 65099237 missense probably benign 0.03
R4684:Cobll1 UTSW 2 65099028 missense possibly damaging 0.90
R4906:Cobll1 UTSW 2 65097693 missense probably benign 0.01
R4923:Cobll1 UTSW 2 65099258 missense possibly damaging 0.87
R5100:Cobll1 UTSW 2 65125901 missense probably benign 0.26
R5269:Cobll1 UTSW 2 65133771 nonsense probably null
R5419:Cobll1 UTSW 2 65103357 missense possibly damaging 0.57
R5637:Cobll1 UTSW 2 65125903 missense possibly damaging 0.90
R5745:Cobll1 UTSW 2 65098457 missense probably damaging 0.99
R5777:Cobll1 UTSW 2 65103268 missense probably benign 0.27
R6303:Cobll1 UTSW 2 65098033 missense possibly damaging 0.68
X0020:Cobll1 UTSW 2 65103322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTGGCTGCACTAACACAC -3'
(R):5'- TGTCAACCCCATCCTAGAGTAG -3'

Sequencing Primer
(F):5'- CAAAGCCCAAGCCACTGTACTG -3'
(R):5'- GTTTGTTTGTTCATGTATCCATTCTC -3'
Posted On2018-05-21