Incidental Mutation 'R6474:Prkacb'
ID516724
Institutional Source Beutler Lab
Gene Symbol Prkacb
Ensembl Gene ENSMUSG00000005034
Gene Nameprotein kinase, cAMP dependent, catalytic, beta
SynonymscAMP-dependent protein kinase C beta, Pkacb
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146729574-146812990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146755724 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 36 (T36S)
Ref Sequence ENSEMBL: ENSMUSP00000101743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005164] [ENSMUST00000102515] [ENSMUST00000106137] [ENSMUST00000106138] [ENSMUST00000197616] [ENSMUST00000199722]
Predicted Effect probably benign
Transcript: ENSMUST00000005164
AA Change: T96S

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005164
Gene: ENSMUSG00000005034
AA Change: T96S

DomainStartEndE-ValueType
S_TKc 91 345 1.07e-105 SMART
S_TK_X 346 398 2.47e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102515
AA Change: T49S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099573
Gene: ENSMUSG00000005034
AA Change: T49S

DomainStartEndE-ValueType
S_TKc 44 298 5.3e-108 SMART
S_TK_X 299 344 2.1e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106137
AA Change: T36S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101743
Gene: ENSMUSG00000005034
AA Change: T36S

DomainStartEndE-ValueType
S_TKc 31 285 1.07e-105 SMART
S_TK_X 286 338 2.47e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106138
AA Change: T37S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101744
Gene: ENSMUSG00000005034
AA Change: T37S

DomainStartEndE-ValueType
S_TKc 32 286 1.07e-105 SMART
S_TK_X 287 339 2.47e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197616
AA Change: T74S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142490
Gene: ENSMUSG00000005034
AA Change: T74S

DomainStartEndE-ValueType
Pfam:Pkinase 69 189 4.6e-27 PFAM
Pfam:Pkinase_Tyr 69 189 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199722
SMART Domains Protein: ENSMUSP00000143303
Gene: ENSMUSG00000005034

DomainStartEndE-ValueType
STYKc 1 106 1.5e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes for a targeted null mutation eliminating the Cbeta1 subunit exhibit impaired hippocampal plasticity, including failure of low frequency stimulation to produce lasting depression and the elimination of mossy fiber long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Prkacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Prkacb APN 3 146748042 missense probably benign 0.01
IGL01330:Prkacb APN 3 146751511 missense probably damaging 1.00
IGL01419:Prkacb APN 3 146755693 start codon destroyed probably null 0.49
IGL02533:Prkacb APN 3 146732696 missense possibly damaging 0.64
PIT4445001:Prkacb UTSW 3 146755691 missense probably benign 0.13
R0666:Prkacb UTSW 3 146751518 missense probably damaging 0.99
R2169:Prkacb UTSW 3 146746683 unclassified probably null
R4559:Prkacb UTSW 3 146745392 unclassified probably benign
R4613:Prkacb UTSW 3 146737998 missense probably damaging 1.00
R4931:Prkacb UTSW 3 146747977 missense possibly damaging 0.91
R6505:Prkacb UTSW 3 146732646 missense probably damaging 1.00
R6654:Prkacb UTSW 3 146750543 missense possibly damaging 0.77
R6864:Prkacb UTSW 3 146745378 missense probably damaging 1.00
R6940:Prkacb UTSW 3 146751499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTGAAGGTGTCAGTGGCAG -3'
(R):5'- TAGGGGCTCACATTGGAAGTG -3'

Sequencing Primer
(F):5'- TGGCAGGCATTCTCACTGACTG -3'
(R):5'- GCTCACATTGGAAGTGAAATATGACC -3'
Posted On2018-05-21