Incidental Mutation 'R6474:Nudt21'
ID516735
Institutional Source Beutler Lab
Gene Symbol Nudt21
Ensembl Gene ENSMUSG00000031754
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 21
Synonyms25kDa, Cpsf5, 5730530J16Rik, 3110048P04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94015496-94037031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94019654 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 139 (V139I)
Ref Sequence ENSEMBL: ENSMUSP00000148485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034204] [ENSMUST00000212622] [ENSMUST00000212911] [ENSMUST00000212981]
Predicted Effect probably benign
Transcript: ENSMUST00000034204
SMART Domains Protein: ENSMUSP00000034204
Gene: ENSMUSG00000031754

DomainStartEndE-ValueType
Pfam:NUDIX_2 35 222 9.9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212622
AA Change: V139I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000212911
Predicted Effect probably benign
Transcript: ENSMUST00000212981
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. This gene encodes the 25kD subunit of the protein complex, which is composed of four polypeptides. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Nudt21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Nudt21 APN 8 94019701 nonsense probably null
PIT4544001:Nudt21 UTSW 8 94019597 missense unknown
R1172:Nudt21 UTSW 8 94031129 splice site probably benign
R1576:Nudt21 UTSW 8 94028833 critical splice donor site probably null
R6293:Nudt21 UTSW 8 94028878 missense probably damaging 1.00
R6961:Nudt21 UTSW 8 94028880 missense probably benign
R7312:Nudt21 UTSW 8 94019599 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGGATCCTCGGCTCTAAGAC -3'
(R):5'- CAGTGAGGTCAATGTTCATTGTAG -3'

Sequencing Primer
(F):5'- TCGGCTCTAAGACTTTTCAGAG -3'
(R):5'- TTAACATGTCGGAAGGGG -3'
Posted On2018-05-21