Incidental Mutation 'R6474:Ccny'
ID516750
Institutional Source Beutler Lab
Gene Symbol Ccny
Ensembl Gene ENSMUSG00000024286
Gene Namecyclin Y
Synonyms5730405I09Rik, 4631402G10Rik, 1700025H17Rik, 3110050L10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location9314044-9450150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9345427 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 149 (L149H)
Ref Sequence ENSEMBL: ENSMUSP00000050001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053917]
Predicted Effect probably damaging
Transcript: ENSMUST00000053917
AA Change: L149H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050001
Gene: ENSMUSG00000024286
AA Change: L149H

DomainStartEndE-ValueType
CYCLIN 173 258 1.36e-7 SMART
Meta Mutation Damage Score 0.588 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cyclins, such as CCNY, control cell division cycles and regulate cyclin-dependent kinases (e.g., CDC2; MIM 116940) (Li et al., 2009 [PubMed 18060517]).[supplied by OMIM, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired adipogenesis and lipid production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Ccny
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Ccny APN 18 9345444 missense probably benign 0.18
IGL01986:Ccny APN 18 9377817 missense probably damaging 1.00
IGL03000:Ccny APN 18 9353489 missense probably benign 0.12
IGL03257:Ccny APN 18 9386747 missense possibly damaging 0.84
R0015:Ccny UTSW 18 9316682 splice site probably benign
R0015:Ccny UTSW 18 9316682 splice site probably benign
R0372:Ccny UTSW 18 9345201 missense probably damaging 1.00
R0440:Ccny UTSW 18 9332917 missense probably benign 0.21
R1645:Ccny UTSW 18 9345199 missense probably damaging 0.99
R2044:Ccny UTSW 18 9449644 missense probably damaging 1.00
R2405:Ccny UTSW 18 9353480 missense probably benign 0.08
R3847:Ccny UTSW 18 9449641 missense probably benign 0.37
R3864:Ccny UTSW 18 9449604 missense probably damaging 1.00
R4198:Ccny UTSW 18 9332928 missense probably damaging 0.96
R4964:Ccny UTSW 18 9449516 critical splice donor site probably null
X0050:Ccny UTSW 18 9332874 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TAAGAGTCTCTGCTGCTCACAC -3'
(R):5'- GCTGTACTTAAGAATACCAGAAATGCC -3'

Sequencing Primer
(F):5'- TGGCACATTCAGCTGTCAG -3'
(R):5'- CCAGAAATGCCTCTTAAATTTAGCAC -3'
Posted On2018-05-21