Incidental Mutation 'R6476:Eml6'
ID516802
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R6476 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 29791971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
Predicted Effect probably null
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A C 19: 5,503,225 I176S probably damaging Het
a T C 2: 155,050,779 V126A probably benign Het
Adamts20 T C 15: 94,361,810 Q336R probably benign Het
Ankrd36 A G 11: 5,628,753 T6A probably benign Het
Arhgap33 A G 7: 30,524,412 S731P probably damaging Het
Arhgef10l G C 4: 140,611,382 P23R probably damaging Het
Atf7 T C 15: 102,593,712 D3G probably benign Het
Caps2 A G 10: 112,175,560 T30A possibly damaging Het
Ccdc15 A T 9: 37,342,419 I191N probably benign Het
Cep170 A T 1: 176,780,351 S180T possibly damaging Het
Chd1 G A 17: 17,380,988 probably null Het
Col6a3 A T 1: 90,781,812 N1887K unknown Het
Csgalnact1 C T 8: 68,461,109 S148N probably damaging Het
Csgalnact1 T A 8: 68,461,110 S148C probably damaging Het
D10Jhu81e T C 10: 78,167,513 N102D probably damaging Het
Dnah14 A G 1: 181,744,768 E2888G probably benign Het
Dnah7b T A 1: 46,242,204 Y2808* probably null Het
Dock10 A C 1: 80,541,242 L1254* probably null Het
Eml2 T C 7: 19,196,311 V511A probably benign Het
Erbin C A 13: 103,841,247 D601Y probably damaging Het
Fam35a T C 14: 34,268,014 S312G probably benign Het
Farsa A G 8: 84,857,180 E49G probably damaging Het
Fzd7 A G 1: 59,483,995 M346V probably damaging Het
Glg1 A C 8: 111,200,174 S170A possibly damaging Het
Gm21994 T C 2: 150,255,326 D61G probably benign Het
Gm340 C T 19: 41,583,079 T237I probably benign Het
Gpx3 A T 11: 54,907,199 I54F probably damaging Het
H6pd G A 4: 149,982,727 H401Y probably damaging Het
Hspb8 A G 5: 116,422,398 S28P probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Krt9 A T 11: 100,190,814 D296E probably damaging Het
Lnx1 A G 5: 74,607,880 V349A possibly damaging Het
Map3k6 A T 4: 133,250,086 S915C probably damaging Het
Mecom C A 3: 29,980,568 A510S possibly damaging Het
Mettl14 A G 3: 123,374,037 I224T probably damaging Het
Mme T C 3: 63,343,635 probably null Het
Nbea T A 3: 56,004,806 T1187S probably benign Het
Ndor1 T C 2: 25,248,142 T444A possibly damaging Het
Nhlrc1 A G 13: 47,014,181 L200P possibly damaging Het
Npc1 G T 18: 12,201,694 S667* probably null Het
Olfr1009 T A 2: 85,721,584 Y60N probably damaging Het
Olfr1214 T A 2: 88,987,377 D275V probably benign Het
Olfr294 C T 7: 86,616,010 V212I probably benign Het
Olfr355 T A 2: 36,927,583 H177L possibly damaging Het
Olfr557 T A 7: 102,699,103 N288K possibly damaging Het
Pds5a A C 5: 65,634,287 I773R possibly damaging Het
Pgr T A 9: 8,964,838 probably null Het
Plscr4 A T 9: 92,490,766 M314L probably benign Het
Polr2m A G 9: 71,483,470 V46A probably benign Het
Ptk2b T A 14: 66,187,474 M174L possibly damaging Het
Sec31a A T 5: 100,386,149 F521I probably benign Het
Serpinb3d T C 1: 107,083,341 N47S probably benign Het
Slc17a2 C A 13: 23,812,586 H25N probably damaging Het
Slc24a3 T A 2: 145,606,830 D431E probably benign Het
Slc9a9 T C 9: 94,685,138 F87L probably benign Het
Spata31 T A 13: 64,917,642 S54T possibly damaging Het
Spata6 T C 4: 111,774,823 S144P probably damaging Het
Sppl2c A G 11: 104,186,769 N132D probably benign Het
Ssu2 C T 6: 112,374,832 G311S probably damaging Het
Syne1 T A 10: 5,154,531 Q6328L possibly damaging Het
Tie1 T C 4: 118,472,865 T1054A possibly damaging Het
Tnfaip6 T G 2: 52,052,316 D212E probably benign Het
Tnxb A G 17: 34,690,192 T1442A probably damaging Het
Trim35 C T 14: 66,308,795 T337M probably damaging Het
Vipr1 T C 9: 121,669,423 V413A probably benign Het
Vmn1r19 C G 6: 57,404,593 Q44E probably damaging Het
Zfp266 G T 9: 20,499,281 H533Q probably damaging Het
Zfp689 T C 7: 127,444,724 S245G probably damaging Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCAACGTACCACAGGCTTTC -3'
(R):5'- TCTTATGTTCCTGGAGGTGAAC -3'

Sequencing Primer
(F):5'- CTTGATCTTAAGCCACAGTGAC -3'
(R):5'- AACTTGTGTTCTGTTACTGTGTCTC -3'
Posted On2018-05-21