Incidental Mutation 'R6477:Utp20'
ID516852
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R6477 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88768918 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1705 (V1705A)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470] [ENSMUST00000218967] [ENSMUST00000220188]
Predicted Effect probably benign
Transcript: ENSMUST00000004470
AA Change: V1705A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: V1705A

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218967
Predicted Effect probably benign
Transcript: ENSMUST00000220188
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,257,630 probably null Het
4933415F23Rik A T 1: 23,101,780 L151Q probably benign Het
Aatk T C 11: 120,018,870 D23G probably benign Het
Abca14 T C 7: 120,325,102 I1659T probably benign Het
Ankdd1a C T 9: 65,502,212 V481M probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Cfap161 T A 7: 83,794,022 R20* probably null Het
Cops7a A T 6: 124,960,176 V184E probably damaging Het
Cpa3 T C 3: 20,239,575 E83G possibly damaging Het
Crls1 C T 2: 132,861,233 S201L probably benign Het
Cyp4f39 C A 17: 32,481,817 S153R probably damaging Het
Ddx54 T A 5: 120,621,778 I410N probably damaging Het
Dido1 T A 2: 180,660,481 T1877S probably benign Het
Dip2c A G 13: 9,623,760 S1079G probably damaging Het
Dnhd1 G A 7: 105,677,886 V681I probably benign Het
Dst A G 1: 34,208,728 probably null Het
Eya2 A G 2: 165,763,761 T362A probably benign Het
Hgs G A 11: 120,469,655 V60M probably damaging Het
Inpp4b A G 8: 81,844,714 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kdr C A 5: 75,968,841 A129S probably benign Het
Lhcgr A T 17: 88,742,373 M575K probably damaging Het
Lsamp G T 16: 42,168,165 probably benign Het
Mcm5 T C 8: 75,112,602 V161A probably benign Het
Mmp14 A T 14: 54,437,658 H249L probably damaging Het
Mroh5 A G 15: 73,790,755 S405P probably damaging Het
Mroh9 C A 1: 163,076,304 L46F probably damaging Het
Mtrr A T 13: 68,570,073 H357Q probably damaging Het
Myrf G A 19: 10,228,785 P89L probably benign Het
Mzb1 C T 18: 35,648,258 probably null Het
Naip6 A G 13: 100,316,008 S182P probably damaging Het
Nmur2 A T 11: 56,029,591 F276Y probably damaging Het
Nudt12 G T 17: 59,011,145 S35Y probably benign Het
Olfr1154 A G 2: 87,902,990 S229P probably damaging Het
Olfr572 T A 7: 102,928,378 V250E probably damaging Het
Olfr657 T C 7: 104,635,679 S2P probably benign Het
Osbpl1a T C 18: 12,756,261 I541V probably benign Het
Parp4 A G 14: 56,647,237 K1258E probably benign Het
Plcxd2 C G 16: 45,980,659 K67N probably damaging Het
Pnpla6 A G 8: 3,536,627 T930A probably benign Het
Pomt1 G A 2: 32,248,716 probably null Het
Pramel6 A G 2: 87,510,602 Y426C possibly damaging Het
Prss27 A G 17: 24,044,261 T83A probably damaging Het
Rbm27 T A 18: 42,333,318 V915E probably damaging Het
Rnf114 T A 2: 167,503,488 D10E probably benign Het
Sbk1 A G 7: 126,291,178 E121G probably damaging Het
Senp6 A T 9: 80,093,625 R39* probably null Het
Sergef A T 7: 46,633,826 I94N probably benign Het
Slc30a9 C T 5: 67,328,524 R183W probably benign Het
Smurf1 C T 5: 144,889,792 R414H possibly damaging Het
Sptb A T 12: 76,606,392 W1566R probably damaging Het
Tenm2 T C 11: 36,010,507 probably null Het
Tnni1 T C 1: 135,805,566 V42A probably benign Het
Tnxb A G 17: 34,719,539 Y3098C probably damaging Het
Ubald2 T C 11: 116,434,574 F46L probably benign Het
Ubqln5 G A 7: 104,128,258 S453F probably damaging Het
Ubr3 A T 2: 69,979,429 R1248* probably null Het
Zfp60 G A 7: 27,749,803 R632H probably benign Het
Zfp638 A G 6: 83,965,578 Y957C probably damaging Het
Zfp825 A T 13: 74,480,910 S162R possibly damaging Het
Zfp831 A C 2: 174,704,167 K1355T probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGACTTGGAGATGCACTCTTG -3'
(R):5'- CTGGAGAAGGCAGTTGCATG -3'

Sequencing Primer
(F):5'- GCTCCTTAGCCACCGTCC -3'
(R):5'- GAGAAGGCAGTTGCATGACTTTATC -3'
Posted On2018-05-21